ID: 902794602

View in Genome Browser
Species Human (GRCh38)
Location 1:18793076-18793098
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794593_902794602 0 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794592_902794602 1 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794595_902794602 -7 Left 902794595 1:18793060-18793082 CCCCAGGAGTAGCTTACATCACC No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794591_902794602 4 Left 902794591 1:18793049-18793071 CCACCCAAGACCCCCAGGAGTAG No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794596_902794602 -8 Left 902794596 1:18793061-18793083 CCCAGGAGTAGCTTACATCACCA No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794590_902794602 5 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794588_902794602 29 Left 902794588 1:18793024-18793046 CCAAGTGAACTTGCTCAGCTGGT No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794594_902794602 -6 Left 902794594 1:18793059-18793081 CCCCCAGGAGTAGCTTACATCAC No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data
902794597_902794602 -9 Left 902794597 1:18793062-18793084 CCAGGAGTAGCTTACATCACCAG No data
Right 902794602 1:18793076-18793098 CATCACCAGGTGAGGGTGGTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr