ID: 902794604

View in Genome Browser
Species Human (GRCh38)
Location 1:18793082-18793104
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902794593_902794604 6 Left 902794593 1:18793053-18793075 CCAAGACCCCCAGGAGTAGCTTA No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794590_902794604 11 Left 902794590 1:18793048-18793070 CCCACCCAAGACCCCCAGGAGTA No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794591_902794604 10 Left 902794591 1:18793049-18793071 CCACCCAAGACCCCCAGGAGTAG No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794597_902794604 -3 Left 902794597 1:18793062-18793084 CCAGGAGTAGCTTACATCACCAG No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794594_902794604 0 Left 902794594 1:18793059-18793081 CCCCCAGGAGTAGCTTACATCAC No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794595_902794604 -1 Left 902794595 1:18793060-18793082 CCCCAGGAGTAGCTTACATCACC No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794592_902794604 7 Left 902794592 1:18793052-18793074 CCCAAGACCCCCAGGAGTAGCTT No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data
902794596_902794604 -2 Left 902794596 1:18793061-18793083 CCCAGGAGTAGCTTACATCACCA No data
Right 902794604 1:18793082-18793104 CAGGTGAGGGTGGTTGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr