ID: 902796605

View in Genome Browser
Species Human (GRCh38)
Location 1:18804545-18804567
Sequence TGAAGGTACCTCCCTTCTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902796605_902796612 3 Left 902796605 1:18804545-18804567 CCCAGAGAAGGGAGGTACCTTCA No data
Right 902796612 1:18804571-18804593 GGGACACTGCCAGGAGTACCGGG No data
902796605_902796611 2 Left 902796605 1:18804545-18804567 CCCAGAGAAGGGAGGTACCTTCA No data
Right 902796611 1:18804570-18804592 AGGGACACTGCCAGGAGTACCGG No data
902796605_902796613 7 Left 902796605 1:18804545-18804567 CCCAGAGAAGGGAGGTACCTTCA No data
Right 902796613 1:18804575-18804597 CACTGCCAGGAGTACCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
902796605_902796614 8 Left 902796605 1:18804545-18804567 CCCAGAGAAGGGAGGTACCTTCA No data
Right 902796614 1:18804576-18804598 ACTGCCAGGAGTACCGGGCTGGG No data
902796605_902796610 -6 Left 902796605 1:18804545-18804567 CCCAGAGAAGGGAGGTACCTTCA No data
Right 902796610 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
902796605_902796617 22 Left 902796605 1:18804545-18804567 CCCAGAGAAGGGAGGTACCTTCA No data
Right 902796617 1:18804590-18804612 CGGGCTGGGTACAGCCCAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902796605 Original CRISPR TGAAGGTACCTCCCTTCTCT GGG (reversed) Intergenic