ID: 902796606

View in Genome Browser
Species Human (GRCh38)
Location 1:18804546-18804568
Sequence GTGAAGGTACCTCCCTTCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902796606_902796617 21 Left 902796606 1:18804546-18804568 CCAGAGAAGGGAGGTACCTTCAC No data
Right 902796617 1:18804590-18804612 CGGGCTGGGTACAGCCCAAGAGG No data
902796606_902796610 -7 Left 902796606 1:18804546-18804568 CCAGAGAAGGGAGGTACCTTCAC No data
Right 902796610 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
902796606_902796613 6 Left 902796606 1:18804546-18804568 CCAGAGAAGGGAGGTACCTTCAC No data
Right 902796613 1:18804575-18804597 CACTGCCAGGAGTACCGGGCTGG No data
902796606_902796612 2 Left 902796606 1:18804546-18804568 CCAGAGAAGGGAGGTACCTTCAC No data
Right 902796612 1:18804571-18804593 GGGACACTGCCAGGAGTACCGGG No data
902796606_902796614 7 Left 902796606 1:18804546-18804568 CCAGAGAAGGGAGGTACCTTCAC No data
Right 902796614 1:18804576-18804598 ACTGCCAGGAGTACCGGGCTGGG No data
902796606_902796611 1 Left 902796606 1:18804546-18804568 CCAGAGAAGGGAGGTACCTTCAC No data
Right 902796611 1:18804570-18804592 AGGGACACTGCCAGGAGTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902796606 Original CRISPR GTGAAGGTACCTCCCTTCTC TGG (reversed) Intergenic