ID: 902796609

View in Genome Browser
Species Human (GRCh38)
Location 1:18804562-18804584
Sequence CCTGGCAGTGTCCCTTGTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902796609_902796617 5 Left 902796609 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
Right 902796617 1:18804590-18804612 CGGGCTGGGTACAGCCCAAGAGG No data
902796609_902796613 -10 Left 902796609 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
Right 902796613 1:18804575-18804597 CACTGCCAGGAGTACCGGGCTGG 0: 1
1: 0
2: 0
3: 9
4: 130
902796609_902796614 -9 Left 902796609 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
Right 902796614 1:18804576-18804598 ACTGCCAGGAGTACCGGGCTGGG No data
902796609_902796619 19 Left 902796609 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
Right 902796619 1:18804604-18804626 CCCAAGAGGATTTGACTCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902796609 Original CRISPR CCTGGCAGTGTCCCTTGTGA AGG (reversed) Intergenic