ID: 902796610

View in Genome Browser
Species Human (GRCh38)
Location 1:18804562-18804584
Sequence CCTTCACAAGGGACACTGCC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902796597_902796610 29 Left 902796597 1:18804510-18804532 CCAACTCCCTCATTACAAAGGTG No data
Right 902796610 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
902796599_902796610 23 Left 902796599 1:18804516-18804538 CCCTCATTACAAAGGTGTGGAAA No data
Right 902796610 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
902796606_902796610 -7 Left 902796606 1:18804546-18804568 CCAGAGAAGGGAGGTACCTTCAC No data
Right 902796610 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
902796605_902796610 -6 Left 902796605 1:18804545-18804567 CCCAGAGAAGGGAGGTACCTTCA No data
Right 902796610 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
902796600_902796610 22 Left 902796600 1:18804517-18804539 CCTCATTACAAAGGTGTGGAAAC No data
Right 902796610 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902796610 Original CRISPR CCTTCACAAGGGACACTGCC AGG Intergenic