ID: 902796611

View in Genome Browser
Species Human (GRCh38)
Location 1:18804570-18804592
Sequence AGGGACACTGCCAGGAGTAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902796606_902796611 1 Left 902796606 1:18804546-18804568 CCAGAGAAGGGAGGTACCTTCAC No data
Right 902796611 1:18804570-18804592 AGGGACACTGCCAGGAGTACCGG No data
902796605_902796611 2 Left 902796605 1:18804545-18804567 CCCAGAGAAGGGAGGTACCTTCA No data
Right 902796611 1:18804570-18804592 AGGGACACTGCCAGGAGTACCGG No data
902796600_902796611 30 Left 902796600 1:18804517-18804539 CCTCATTACAAAGGTGTGGAAAC No data
Right 902796611 1:18804570-18804592 AGGGACACTGCCAGGAGTACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902796611 Original CRISPR AGGGACACTGCCAGGAGTAC CGG Intergenic