ID: 902796612

View in Genome Browser
Species Human (GRCh38)
Location 1:18804571-18804593
Sequence GGGACACTGCCAGGAGTACC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902796606_902796612 2 Left 902796606 1:18804546-18804568 CCAGAGAAGGGAGGTACCTTCAC No data
Right 902796612 1:18804571-18804593 GGGACACTGCCAGGAGTACCGGG No data
902796605_902796612 3 Left 902796605 1:18804545-18804567 CCCAGAGAAGGGAGGTACCTTCA No data
Right 902796612 1:18804571-18804593 GGGACACTGCCAGGAGTACCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902796612 Original CRISPR GGGACACTGCCAGGAGTACC GGG Intergenic