ID: 902796613

View in Genome Browser
Species Human (GRCh38)
Location 1:18804575-18804597
Sequence CACTGCCAGGAGTACCGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902796606_902796613 6 Left 902796606 1:18804546-18804568 CCAGAGAAGGGAGGTACCTTCAC No data
Right 902796613 1:18804575-18804597 CACTGCCAGGAGTACCGGGCTGG No data
902796605_902796613 7 Left 902796605 1:18804545-18804567 CCCAGAGAAGGGAGGTACCTTCA No data
Right 902796613 1:18804575-18804597 CACTGCCAGGAGTACCGGGCTGG No data
902796609_902796613 -10 Left 902796609 1:18804562-18804584 CCTTCACAAGGGACACTGCCAGG No data
Right 902796613 1:18804575-18804597 CACTGCCAGGAGTACCGGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902796613 Original CRISPR CACTGCCAGGAGTACCGGGC TGG Intergenic