ID: 902797279

View in Genome Browser
Species Human (GRCh38)
Location 1:18807885-18807907
Sequence ACCGGGAAGGAGAACTGGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902797279_902797285 3 Left 902797279 1:18807885-18807907 CCTTCCCAGTTCTCCTTCCCGGT No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797279_902797287 16 Left 902797279 1:18807885-18807907 CCTTCCCAGTTCTCCTTCCCGGT No data
Right 902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG No data
902797279_902797291 22 Left 902797279 1:18807885-18807907 CCTTCCCAGTTCTCCTTCCCGGT No data
Right 902797291 1:18807930-18807952 ATGGCTCCTCCCACCGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902797279 Original CRISPR ACCGGGAAGGAGAACTGGGA AGG (reversed) Intergenic
No off target data available for this crispr