ID: 902797285

View in Genome Browser
Species Human (GRCh38)
Location 1:18807911-18807933
Sequence AAACAAGTTCCTTCACCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902797281_902797285 -2 Left 902797281 1:18807890-18807912 CCAGTTCTCCTTCCCGGTAGTAA No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797274_902797285 27 Left 902797274 1:18807861-18807883 CCAAAGGTATAGGTGTCACCCCT No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797279_902797285 3 Left 902797279 1:18807885-18807907 CCTTCCCAGTTCTCCTTCCCGGT No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797276_902797285 8 Left 902797276 1:18807880-18807902 CCCTGCCTTCCCAGTTCTCCTTC No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797271_902797285 30 Left 902797271 1:18807858-18807880 CCCCCAAAGGTATAGGTGTCACC No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797272_902797285 29 Left 902797272 1:18807859-18807881 CCCCAAAGGTATAGGTGTCACCC No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797282_902797285 -10 Left 902797282 1:18807898-18807920 CCTTCCCGGTAGTAAACAAGTTC No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797280_902797285 -1 Left 902797280 1:18807889-18807911 CCCAGTTCTCCTTCCCGGTAGTA No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797277_902797285 7 Left 902797277 1:18807881-18807903 CCTGCCTTCCCAGTTCTCCTTCC No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797275_902797285 9 Left 902797275 1:18807879-18807901 CCCCTGCCTTCCCAGTTCTCCTT No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data
902797273_902797285 28 Left 902797273 1:18807860-18807882 CCCAAAGGTATAGGTGTCACCCC No data
Right 902797285 1:18807911-18807933 AAACAAGTTCCTTCACCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902797285 Original CRISPR AAACAAGTTCCTTCACCCCA TGG Intergenic
No off target data available for this crispr