ID: 902797287

View in Genome Browser
Species Human (GRCh38)
Location 1:18807924-18807946
Sequence CACCCCATGGCTCCTCCCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902797280_902797287 12 Left 902797280 1:18807889-18807911 CCCAGTTCTCCTTCCCGGTAGTA No data
Right 902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG No data
902797281_902797287 11 Left 902797281 1:18807890-18807912 CCAGTTCTCCTTCCCGGTAGTAA No data
Right 902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG No data
902797284_902797287 -2 Left 902797284 1:18807903-18807925 CCGGTAGTAAACAAGTTCCTTCA No data
Right 902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG No data
902797275_902797287 22 Left 902797275 1:18807879-18807901 CCCCTGCCTTCCCAGTTCTCCTT No data
Right 902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG No data
902797276_902797287 21 Left 902797276 1:18807880-18807902 CCCTGCCTTCCCAGTTCTCCTTC No data
Right 902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG No data
902797282_902797287 3 Left 902797282 1:18807898-18807920 CCTTCCCGGTAGTAAACAAGTTC No data
Right 902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG No data
902797283_902797287 -1 Left 902797283 1:18807902-18807924 CCCGGTAGTAAACAAGTTCCTTC No data
Right 902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG No data
902797277_902797287 20 Left 902797277 1:18807881-18807903 CCTGCCTTCCCAGTTCTCCTTCC No data
Right 902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG No data
902797279_902797287 16 Left 902797279 1:18807885-18807907 CCTTCCCAGTTCTCCTTCCCGGT No data
Right 902797287 1:18807924-18807946 CACCCCATGGCTCCTCCCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902797287 Original CRISPR CACCCCATGGCTCCTCCCAC CGG Intergenic
No off target data available for this crispr