ID: 902797291

View in Genome Browser
Species Human (GRCh38)
Location 1:18807930-18807952
Sequence ATGGCTCCTCCCACCGGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902797283_902797291 5 Left 902797283 1:18807902-18807924 CCCGGTAGTAAACAAGTTCCTTC No data
Right 902797291 1:18807930-18807952 ATGGCTCCTCCCACCGGCCTTGG No data
902797282_902797291 9 Left 902797282 1:18807898-18807920 CCTTCCCGGTAGTAAACAAGTTC No data
Right 902797291 1:18807930-18807952 ATGGCTCCTCCCACCGGCCTTGG No data
902797279_902797291 22 Left 902797279 1:18807885-18807907 CCTTCCCAGTTCTCCTTCCCGGT No data
Right 902797291 1:18807930-18807952 ATGGCTCCTCCCACCGGCCTTGG No data
902797280_902797291 18 Left 902797280 1:18807889-18807911 CCCAGTTCTCCTTCCCGGTAGTA No data
Right 902797291 1:18807930-18807952 ATGGCTCCTCCCACCGGCCTTGG No data
902797281_902797291 17 Left 902797281 1:18807890-18807912 CCAGTTCTCCTTCCCGGTAGTAA No data
Right 902797291 1:18807930-18807952 ATGGCTCCTCCCACCGGCCTTGG No data
902797277_902797291 26 Left 902797277 1:18807881-18807903 CCTGCCTTCCCAGTTCTCCTTCC No data
Right 902797291 1:18807930-18807952 ATGGCTCCTCCCACCGGCCTTGG No data
902797276_902797291 27 Left 902797276 1:18807880-18807902 CCCTGCCTTCCCAGTTCTCCTTC No data
Right 902797291 1:18807930-18807952 ATGGCTCCTCCCACCGGCCTTGG No data
902797284_902797291 4 Left 902797284 1:18807903-18807925 CCGGTAGTAAACAAGTTCCTTCA No data
Right 902797291 1:18807930-18807952 ATGGCTCCTCCCACCGGCCTTGG No data
902797275_902797291 28 Left 902797275 1:18807879-18807901 CCCCTGCCTTCCCAGTTCTCCTT No data
Right 902797291 1:18807930-18807952 ATGGCTCCTCCCACCGGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902797291 Original CRISPR ATGGCTCCTCCCACCGGCCT TGG Intergenic
No off target data available for this crispr