ID: 902799507

View in Genome Browser
Species Human (GRCh38)
Location 1:18820528-18820550
Sequence TGTGCACGCGGGTGTGCGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902799507_902799515 -7 Left 902799507 1:18820528-18820550 CCCCTCGCACACCCGCGTGCACA No data
Right 902799515 1:18820544-18820566 GTGCACACACGGGTCTCCGTGGG No data
902799507_902799514 -8 Left 902799507 1:18820528-18820550 CCCCTCGCACACCCGCGTGCACA No data
Right 902799514 1:18820543-18820565 CGTGCACACACGGGTCTCCGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902799507 Original CRISPR TGTGCACGCGGGTGTGCGAG GGG (reversed) Intergenic