ID: 902801094

View in Genome Browser
Species Human (GRCh38)
Location 1:18830764-18830786
Sequence TAGCACCCCAGACCCCGCGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902801091_902801094 8 Left 902801091 1:18830733-18830755 CCGCTTCTGTGCACGAGGGTCTG No data
Right 902801094 1:18830764-18830786 TAGCACCCCAGACCCCGCGGTGG No data
902801088_902801094 12 Left 902801088 1:18830729-18830751 CCTCCCGCTTCTGTGCACGAGGG No data
Right 902801094 1:18830764-18830786 TAGCACCCCAGACCCCGCGGTGG No data
902801090_902801094 9 Left 902801090 1:18830732-18830754 CCCGCTTCTGTGCACGAGGGTCT No data
Right 902801094 1:18830764-18830786 TAGCACCCCAGACCCCGCGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902801094 Original CRISPR TAGCACCCCAGACCCCGCGG TGG Intergenic
No off target data available for this crispr