ID: 902802712

View in Genome Browser
Species Human (GRCh38)
Location 1:18840267-18840289
Sequence GCTGCTGGTGGCATACATGG TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 192
Summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 177}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902802712_902802717 2 Left 902802712 1:18840267-18840289 CCACCATGTATGCCACCAGCAGC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 902802717 1:18840292-18840314 TGTCAGCATCAGGAAGCACATGG 0: 1
1: 0
2: 1
3: 22
4: 289
902802712_902802720 26 Left 902802712 1:18840267-18840289 CCACCATGTATGCCACCAGCAGC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 902802720 1:18840316-18840338 GCCCCCAGCCGAGCGAACTATGG 0: 1
1: 0
2: 0
3: 1
4: 60
902802712_902802716 -8 Left 902802712 1:18840267-18840289 CCACCATGTATGCCACCAGCAGC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 902802716 1:18840282-18840304 CCAGCAGCAGTGTCAGCATCAGG 0: 1
1: 0
2: 10
3: 94
4: 578
902802712_902802718 3 Left 902802712 1:18840267-18840289 CCACCATGTATGCCACCAGCAGC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 902802718 1:18840293-18840315 GTCAGCATCAGGAAGCACATGGG 0: 1
1: 0
2: 1
3: 11
4: 175
902802712_902802722 27 Left 902802712 1:18840267-18840289 CCACCATGTATGCCACCAGCAGC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 902802722 1:18840317-18840339 CCCCCAGCCGAGCGAACTATGGG 0: 1
1: 0
2: 0
3: 1
4: 16
902802712_902802719 4 Left 902802712 1:18840267-18840289 CCACCATGTATGCCACCAGCAGC 0: 1
1: 0
2: 1
3: 13
4: 177
Right 902802719 1:18840294-18840316 TCAGCATCAGGAAGCACATGGGG 0: 1
1: 0
2: 2
3: 21
4: 206

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902802712 Original CRISPR GCTGCTGGTGGCATACATGG TGG (reversed) Exonic
900415611 1:2533143-2533165 GCTGCTGGGGGCAGCCAAGGTGG - Intergenic
900592812 1:3467487-3467509 GCTGTGGGTGGCAGACCTGGGGG + Intronic
901484518 1:9549312-9549334 ACTGCTGGTGGGATCAATGGGGG + Intronic
902205502 1:14865466-14865488 GCAGCAGATGGCAGACATGGGGG - Intronic
902772482 1:18653565-18653587 GCTGCTGATGACATGGATGGAGG + Intronic
902802712 1:18840267-18840289 GCTGCTGGTGGCATACATGGTGG - Exonic
903478325 1:23635519-23635541 GCTGCTGGTGTTAGACTTGGGGG + Intronic
904703936 1:32376472-32376494 GCTGCTAGAGGCATCCTTGGAGG - Exonic
905583529 1:39100102-39100124 GCTGCTGGTGGGTTAATTGGTGG + Intronic
906052711 1:42888022-42888044 GCTGCTCGTGGCCTTCATTGTGG - Intergenic
907021823 1:51073708-51073730 GCTGCAGGTGGCCTTAATGGTGG + Intergenic
907298310 1:53469688-53469710 GCTGCTGGAGGCCTGCCTGGAGG - Intergenic
910674300 1:89801339-89801361 GCTGATGGGGAGATACATGGGGG - Intronic
914847901 1:151292923-151292945 GCTGCTGGTGGAGCAGATGGTGG - Exonic
917474461 1:175356359-175356381 TCCATTGGTGGCATACATGGTGG + Exonic
919835327 1:201569276-201569298 GCTGCTGGTTGCCTACCAGGAGG - Intergenic
924743235 1:246809845-246809867 GCTGCTGCTGGCATTCATGTTGG + Intergenic
1063123984 10:3124177-3124199 GCTACTGGTGGGACACAGGGCGG - Intronic
1071489716 10:86128086-86128108 GCTGCTGGTGGCACAGAGGAAGG - Intronic
1073560905 10:104496041-104496063 GCTGCTGGGGCCACATATGGAGG - Intergenic
1073709269 10:106019707-106019729 GCTGCTGCAGGCAGACATGAGGG + Intergenic
1075746527 10:124731996-124732018 GCTGATCCTGGCAGACATGGAGG - Intronic
1077137627 11:1009086-1009108 GCTGCTGCTGGCAGGTATGGGGG + Exonic
1077555214 11:3222646-3222668 GGTGCGGGTGGAATACGTGGAGG + Intergenic
1078268121 11:9770119-9770141 GATGTTGGTGGCTTACCTGGTGG - Intergenic
1078355147 11:10627442-10627464 GCTGCTGGTTGGAGACAAGGGGG - Intronic
1080888780 11:36390324-36390346 GGTGCTGGTGGAAGACATGAAGG + Intronic
1081649945 11:44817154-44817176 GCAGCTGATGGCATGCACGGTGG + Intronic
1086305253 11:85472739-85472761 GGTGCTGGTGGAGTACACGGGGG - Intronic
1090875989 11:130789498-130789520 ACTGGTGGTGGCATAAGTGGGGG - Intergenic
1091130417 11:133142153-133142175 TCTGCTGGTAGAAGACATGGTGG - Intronic
1091924577 12:4334715-4334737 GCAGCTGGTGGTAAACATAGTGG + Intronic
1092412438 12:8264110-8264132 CCTGCTGGGTGCAGACATGGTGG + Intergenic
1092686890 12:11058680-11058702 GCTGTTAGAGGCATACATAGTGG + Intronic
1092688108 12:11073763-11073785 GCTGCTAGAGGCATGCATCGTGG + Intronic
1092692616 12:11130607-11130629 GCTGCTAGAGGCATGCATAGTGG + Intronic
1092731291 12:11537689-11537711 GCTGTTGGTCACATACCTGGAGG + Intergenic
1092745291 12:11667271-11667293 GGTTCTGGTAGCATTCATGGAGG - Intronic
1096681084 12:53255670-53255692 GGTGCTGGTGGAATGCAGGGTGG + Intergenic
1099927982 12:89041115-89041137 GCTGGTGGTGGGATGGATGGGGG + Intergenic
1102582764 12:113901417-113901439 GCTACTGCTGGCATACTTTGGGG + Intronic
1103331373 12:120156560-120156582 ACTGCTGCTGGCACACAGGGTGG + Exonic
1104832178 12:131760784-131760806 GTTGCTGGGGCCAGACATGGTGG + Intronic
1113929888 13:113962655-113962677 GCTGCTGGTGGCGTGCAGTGGGG - Intergenic
1114648787 14:24270229-24270251 GCAGCCAGTGGCATAGATGGAGG - Intronic
1115164856 14:30436882-30436904 GATGCTGGTGGCCTCTATGGAGG - Intergenic
1115433713 14:33349818-33349840 GATGCTAGTGGCATAACTGGAGG + Intronic
1118667261 14:68084510-68084532 ACTGCTGTGGACATACATGGTGG + Intronic
1118931331 14:70244082-70244104 GCTACTGGAGCCATACAAGGAGG - Intergenic
1118953837 14:70461044-70461066 GCTACTGGAGCCATACAAGGAGG + Intergenic
1122144248 14:99679759-99679781 GAGGCTGGTGGCATCCATGCTGG + Exonic
1122638330 14:103141162-103141184 GATGGTGGGGGCATGCATGGGGG - Intergenic
1123857350 15:24426939-24426961 GCAGGTGGTGGGATCCATGGAGG + Intergenic
1129789868 15:78333770-78333792 CTTGCTGGTGGCCTGCATGGAGG - Intergenic
1136318781 16:29469064-29469086 GCTGCTGGGGGCTTGCATGCAGG + Intergenic
1136433353 16:30208408-30208430 GCTGCTGGGGGCTTGCATGCAGG + Intronic
1136494866 16:30636483-30636505 GCTGGTGGTGGCACAATTGGAGG + Intergenic
1137232010 16:46575049-46575071 GCTGCAGGTGGCATTGATGGCGG + Intergenic
1139291310 16:65860477-65860499 GCTGCAGGTGGCATCCAGGAGGG - Intergenic
1139490875 16:67285296-67285318 GCTGGTGCTGGCAGAGATGGTGG + Exonic
1139800012 16:69514899-69514921 GCTGATGGTGGCTTGGATGGAGG - Intergenic
1140323511 16:73977455-73977477 GCAGCTGGTGGCAGCCATGCTGG - Intergenic
1140542784 16:75774015-75774037 GCTGCTGTTGTCATCCATGGTGG + Intergenic
1141701510 16:85644404-85644426 TCAGCTGGTGGCATACAGGCTGG - Intronic
1141848713 16:86629520-86629542 TCTGATGGTGGCAAACGTGGTGG + Intergenic
1142363068 16:89636370-89636392 ACTGCTGGTGACATACAGGAAGG - Exonic
1143184599 17:5002745-5002767 GCTGCTGGTCTCATTCATGTTGG - Exonic
1143448086 17:7020341-7020363 GGTGCTGGTGGGGTACAAGGAGG - Intergenic
1146524231 17:33552336-33552358 GCTGCTGGAGGCATGGAGGGTGG + Intronic
1146637672 17:34518364-34518386 GCTGGTGCTGGCACACCTGGAGG + Intergenic
1146696104 17:34910026-34910048 GCTGCTGTTGGCAGTGATGGTGG - Intergenic
1147965248 17:44191202-44191224 GGTGCTGGGGGCAGACATGCAGG - Exonic
1148117173 17:45182959-45182981 CCTGCTGGTGGCACACATGGGGG + Intergenic
1149496033 17:57118097-57118119 GCTGCTGGTGGTATTGGTGGTGG + Intronic
1152068635 17:78124601-78124623 GCTGCTGGTGGCCTTCATCATGG - Exonic
1152701112 17:81820120-81820142 GGTGCTGGGGCCATACCTGGGGG + Intergenic
1153129870 18:1842801-1842823 ACAACTGGTGGCATACTTGGTGG - Intergenic
1153443904 18:5151156-5151178 GCTGCTGCTGGTAAACAGGGAGG + Intronic
1153526275 18:5997903-5997925 GCTGCTTTTGGTATCCATGGGGG + Intronic
1156473587 18:37392268-37392290 GCTGTGGGTGGCTTTCATGGAGG - Intronic
1156967577 18:43113844-43113866 GCTGCTGGTGGCATTTAATGTGG + Intronic
1157206838 18:45707810-45707832 GCTGGTGGTGGCATTGGTGGTGG + Intergenic
1157501802 18:48196004-48196026 GCTGGTGGGAGCAGACATGGTGG + Intronic
1158983623 18:62790683-62790705 CCTGGTGGTGGCATGCATGCTGG + Intronic
1159622266 18:70651849-70651871 GATGCTGGTGGCATTCACAGAGG + Intergenic
1161315550 19:3615670-3615692 GCTGCTGGTGACACACTGGGCGG + Intronic
1162930841 19:13956728-13956750 GCTGCTGGAGGCAGCCATGGTGG - Intronic
1163725419 19:18920697-18920719 CCTGCTGGGGGCTTACCTGGTGG - Exonic
1165348928 19:35266395-35266417 GGTGCTGGGGGCATAAATGCTGG - Exonic
1166160801 19:40951428-40951450 CCTGCTGGTGGAATATGTGGAGG - Intergenic
926121730 2:10244964-10244986 GCTGCTGTTGGAAGAGATGGGGG + Intergenic
926242891 2:11101663-11101685 GCTGCTGGAGGCTTAGGTGGTGG - Intergenic
932246316 2:70199663-70199685 GCTGCAGGTGGGACACATGAGGG - Intronic
935418478 2:102842914-102842936 GATGCTGATGACATACATGGAGG + Intronic
935634905 2:105242757-105242779 GGTGCTGGTGGCGTAGAAGGAGG - Exonic
938711311 2:133978252-133978274 GCTGTTGGTGGGACACAAGGAGG + Intergenic
941885223 2:170520871-170520893 CCTCCTGGTGACATACATGATGG - Intronic
1170914613 20:20610614-20610636 GAAGTCGGTGGCATACATGGTGG - Intronic
1172871375 20:38137540-38137562 GCAGCTGGTGGCAGCCATGCTGG + Intronic
1175205891 20:57310882-57310904 CCAGCTGGTGGCATAGATGGGGG - Intergenic
1175381555 20:58567606-58567628 GCAGTGGGTGGCATCCATGGCGG + Intergenic
1176028653 20:62999517-62999539 GCTGCTGGTGGAAGAAACGGAGG - Intergenic
1176516560 21:7788896-7788918 ACTCCTGGGGGCATACAAGGAGG - Intergenic
1176844682 21:13867836-13867858 GATGCTGGTATCCTACATGGGGG - Intergenic
1178650588 21:34418908-34418930 ACTCCTGGGGGCATACAAGGAGG - Exonic
1179274902 21:39883259-39883281 GCTGTAGCTGGCATAAATGGAGG + Intronic
1179505725 21:41838995-41839017 GCTGCAGGTGGCTTGGATGGGGG + Intronic
1181055920 22:20260459-20260481 GTTCCTGGTGGCATGCGTGGAGG + Intronic
1181237621 22:21457171-21457193 GCTGCTGGAGGAAGACAAGGTGG + Intergenic
1183223059 22:36529495-36529517 GGTGACGGTGGGATACATGGGGG - Intergenic
950196258 3:11011207-11011229 GATGATGGTGGCTTGCATGGGGG - Intronic
950305601 3:11913506-11913528 GCTGCTGGTGGTGTGGATGGAGG - Intergenic
950429268 3:12941496-12941518 CCTGGTGGGGGCACACATGGTGG + Intronic
952828332 3:37542531-37542553 GCTGCAGCTGACTTACATGGAGG + Exonic
954296759 3:49678708-49678730 GCAGCTTGTAGCACACATGGGGG - Intronic
955574928 3:60350628-60350650 ACTGTTGGTGGAATACAGGGAGG - Intronic
959815779 3:110671722-110671744 TCTGCTGGTTGCAAACACGGTGG - Intergenic
960126617 3:114005692-114005714 GCTGTTGCTGGAAGACATGGCGG + Exonic
960916584 3:122701516-122701538 GCTGCTGGTGGTAAACCTGGCGG - Exonic
961386542 3:126526240-126526262 CCTGCAGGTGGCACACAGGGAGG + Intronic
961540220 3:127594352-127594374 GATACTAGAGGCATACATGGTGG + Intronic
963105624 3:141644824-141644846 GCTGATGGGGGTATAAATGGAGG - Intergenic
966046315 3:175554563-175554585 TCTTCTGGTGGGTTACATGGGGG + Intronic
967778407 3:193408555-193408577 GCTGCTGGGAGGATAAATGGTGG + Intronic
968762512 4:2449939-2449961 GCTGCTGAGGGCAAACATCGAGG + Exonic
968764555 4:2461481-2461503 GCTGCTGGTGCTGTACAGGGCGG + Intronic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
969998827 4:11343372-11343394 GCTGCTTGTGCCACACAGGGTGG - Intergenic
973573854 4:52266309-52266331 GCTGCTGGTGGAAAAAATGCAGG - Intergenic
975394937 4:73863847-73863869 GCTGGGGGTGGCATACAGGAAGG + Intergenic
977668193 4:99665319-99665341 GCTGCTGAAGGCATACAGAGAGG - Intergenic
978862219 4:113464042-113464064 GGTGGTGGTGGCAGATATGGGGG - Intronic
984157031 4:176206184-176206206 GCTGCAGGTGGCAGTTATGGAGG + Intergenic
984157200 4:176207314-176207336 GCTGCAGGTGGCAGGGATGGAGG + Intergenic
984474288 4:180216576-180216598 GCTGCTGCTGGCCCACATGTGGG - Intergenic
985144811 4:186885602-186885624 GCTGCTGGGCACAGACATGGTGG + Intergenic
986225841 5:5811505-5811527 CCTGTTGGTGGCACACATGGGGG + Intergenic
986311788 5:6556679-6556701 GCATCTGGTGGCATTCATGGGGG + Intergenic
987035813 5:14017311-14017333 GTTGCTGGGGGCAGTCATGGAGG - Intergenic
990206520 5:53435265-53435287 GCTGCTTGTGCCAGGCATGGTGG - Intergenic
995940354 5:117574951-117574973 GCTGCTGTAGGCATACCTGAAGG - Intergenic
998292437 5:140927804-140927826 GCTCTTGGAGGCATACATTGAGG + Exonic
1000312328 5:160056940-160056962 GCTGCTGAAGCCATACATGTAGG + Intronic
1002190100 5:177473464-177473486 GCTGCTGGCGGCTTACGAGGAGG - Intronic
1003076593 6:2988469-2988491 GCTGGTGGAGGGATGCATGGCGG + Intronic
1004252618 6:14034519-14034541 GCTGGTTGTAGCATGCATGGGGG + Intergenic
1004275717 6:14233523-14233545 GATGGTGGTGGTATTCATGGAGG + Intergenic
1006632003 6:35436567-35436589 CCTGCTGGTGGGAGGCATGGAGG - Intergenic
1006906487 6:37536747-37536769 GCGGCTGGTGGCGGAGATGGAGG + Intergenic
1007079062 6:39085985-39086007 GCTGCTGGTGGGACACTTGAGGG - Exonic
1007584234 6:42978976-42978998 GCTGCTGGTGGCAGCCCTGGAGG - Exonic
1011769352 6:90658851-90658873 GCTGCAGGTGGCTTACAGGATGG + Intergenic
1015755393 6:136600913-136600935 TCTGCTCCTGGCTTACATGGGGG - Intronic
1017416768 6:154229070-154229092 GGGGCTGGAGGCAGACATGGGGG - Intronic
1018276114 6:162133316-162133338 GCTGCTGATGGATTAGATGGGGG + Intronic
1019319642 7:409770-409792 GCTGCAGGTGGCATCCCAGGAGG + Intergenic
1019613980 7:1950625-1950647 GCAGCTGGGGGCAGACATTGAGG - Intronic
1019723385 7:2587019-2587041 GCTGCTGGTGGCCTGGATGGGGG + Intronic
1020287864 7:6699441-6699463 GCTGCTGATGGGACACACGGTGG + Intronic
1023311865 7:38895744-38895766 GCTGCTTTTGGCAGAGATGGGGG - Intronic
1024855902 7:53778991-53779013 GCTGCTGGTTCAATACATGTTGG - Intergenic
1024957035 7:54933262-54933284 GCAGCTGGTGGCAGAGAGGGAGG + Intergenic
1026471613 7:70697972-70697994 AATGCTGGTGGCATGCATAGTGG + Intronic
1028754301 7:94417796-94417818 GGTGCTGCTGGCATACCTGGAGG + Exonic
1029095656 7:98083372-98083394 TCTGCTGGTGGCATTTATGTGGG - Intergenic
1032069391 7:128794529-128794551 GCAGCTGGTGGCAGAACTGGAGG + Exonic
1032419299 7:131764973-131764995 GCTGATGGAGGCACCCATGGTGG + Intergenic
1033808122 7:144977617-144977639 GGTCCTGGTGGCCTACCTGGTGG - Intergenic
1035039360 7:155916362-155916384 GATGGTGGTGGCAGCCATGGAGG - Intergenic
1035515053 8:225785-225807 GCACATGGTGGCAGACATGGTGG + Intergenic
1037399199 8:18476641-18476663 CCAGCTGGTGGCAGAGATGGTGG - Intergenic
1038865871 8:31438388-31438410 GCTACTGGTGGAATGCAAGGAGG + Intergenic
1041897806 8:62946326-62946348 GCTGCTTATGGCATACCTAGTGG - Intronic
1042282615 8:67070524-67070546 GATTCTGGTGGCCAACATGGAGG + Intronic
1042768855 8:72356812-72356834 GCTGCTGGTGGAGTACATTCAGG + Intergenic
1044915944 8:97112781-97112803 AGTGCTGATGGCGTACATGGAGG + Intronic
1049423779 8:142528326-142528348 GCTGCAAGTGGCAGGCATGGGGG - Intronic
1049525809 8:143126371-143126393 GCTGCAGGTGGCAAAGGTGGGGG + Intergenic
1049681804 8:143922161-143922183 GCGGCTGGTGGCCAGCATGGAGG - Exonic
1055472014 9:76621349-76621371 GTTGCTGGTGGCCGAGATGGTGG + Intronic
1056717020 9:89040066-89040088 GGTGCTGGTGGCAAAGGTGGTGG - Intronic
1060247628 9:121959461-121959483 GCTGCTGGTGCCAGTCATGGAGG - Intronic
1061500990 9:131001763-131001785 GGTGCTGGTGGAATCCATGCTGG - Intergenic
1061887365 9:133598588-133598610 GCTGCTGGTGGGAGAGAGGGAGG + Intergenic
1185734963 X:2489460-2489482 GCTGATGGTGGGGTACCTGGAGG + Exonic
1185858210 X:3555214-3555236 GCTGCTGCAGGCAGACATGATGG + Intergenic
1185991275 X:4895212-4895234 GCTGCTGCAGGCAGACATGAGGG - Intergenic
1190059349 X:47200968-47200990 GCTGGTGGTGGCAGACACGCGGG + Exonic
1190911529 X:54776064-54776086 GCTGCTGGGGGCAGAGTTGGAGG - Intronic
1191881507 X:65847671-65847693 GCTGATGCTGTCATACAAGGAGG - Intergenic
1199164049 X:144648762-144648784 GCTGCTGCTGCCACATATGGGGG + Intergenic
1202054376 Y:20814568-20814590 TATGGTGGTGGCATACAGGGTGG - Intergenic