ID: 902802751

View in Genome Browser
Species Human (GRCh38)
Location 1:18840436-18840458
Sequence GGCAGCTGGTCTTCCTGGAA TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 257}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902802751_902802760 24 Left 902802751 1:18840436-18840458 CCATTCCAGGAAGACCAGCTGCC 0: 1
1: 0
2: 1
3: 27
4: 257
Right 902802760 1:18840483-18840505 GGTAGGACCACTCGTTATTCGGG 0: 1
1: 0
2: 0
3: 5
4: 40
902802751_902802755 -8 Left 902802751 1:18840436-18840458 CCATTCCAGGAAGACCAGCTGCC 0: 1
1: 0
2: 1
3: 27
4: 257
Right 902802755 1:18840451-18840473 CAGCTGCCGCTTGAAGCAGGAGG 0: 1
1: 0
2: 4
3: 13
4: 144
902802751_902802761 28 Left 902802751 1:18840436-18840458 CCATTCCAGGAAGACCAGCTGCC 0: 1
1: 0
2: 1
3: 27
4: 257
Right 902802761 1:18840487-18840509 GGACCACTCGTTATTCGGGCAGG 0: 1
1: 0
2: 0
3: 1
4: 11
902802751_902802757 3 Left 902802751 1:18840436-18840458 CCATTCCAGGAAGACCAGCTGCC 0: 1
1: 0
2: 1
3: 27
4: 257
Right 902802757 1:18840462-18840484 TGAAGCAGGAGGTCTCACTCTGG 0: 1
1: 0
2: 2
3: 14
4: 176
902802751_902802759 23 Left 902802751 1:18840436-18840458 CCATTCCAGGAAGACCAGCTGCC 0: 1
1: 0
2: 1
3: 27
4: 257
Right 902802759 1:18840482-18840504 TGGTAGGACCACTCGTTATTCGG 0: 1
1: 0
2: 0
3: 0
4: 38
902802751_902802758 7 Left 902802751 1:18840436-18840458 CCATTCCAGGAAGACCAGCTGCC 0: 1
1: 0
2: 1
3: 27
4: 257
Right 902802758 1:18840466-18840488 GCAGGAGGTCTCACTCTGGTAGG 0: 1
1: 0
2: 2
3: 11
4: 149

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902802751 Original CRISPR GGCAGCTGGTCTTCCTGGAA TGG (reversed) Exonic
900336319 1:2165803-2165825 GGCACCTTGCATTCCTGGAAGGG + Intronic
900951222 1:5859200-5859222 AGCAGCTGCTTTTCCTGGAGAGG - Intergenic
901284478 1:8066217-8066239 GGCAGCTGGACTGCAGGGAAGGG - Intergenic
902802751 1:18840436-18840458 GGCAGCTGGTCTTCCTGGAATGG - Exonic
903688018 1:25146728-25146750 GGCAGCCGGACCTCCTGGGAGGG - Intergenic
904212375 1:28894543-28894565 GGCAACTGGACTTCCTGGAGAGG + Intronic
904779424 1:32934297-32934319 GTCATCTGGTCTTCAGGGAAAGG + Intergenic
905053774 1:35075810-35075832 GGCAGCTTTACTTCCAGGAAAGG + Intronic
905446247 1:38030083-38030105 GGCAGCTGGCCTCCCTGGGCAGG - Intergenic
912369424 1:109162094-109162116 TGCAGCTGCTCTGCCAGGAAGGG - Intronic
913217576 1:116633294-116633316 CTCTGCTGGACTTCCTGGAATGG - Intronic
914747488 1:150510867-150510889 TGGAGCTGGCGTTCCTGGAATGG - Exonic
914891196 1:151625086-151625108 GGCATCTGGTCTTCCCAAAAAGG - Intronic
915586102 1:156844817-156844839 GGCTGATGGTATTCCAGGAAAGG - Exonic
916747404 1:167695053-167695075 GCTAGCTGGACTTCCTAGAATGG - Intronic
919934928 1:202245178-202245200 GGCAGATGGCCTCCCTGGCATGG + Intronic
920196034 1:204228035-204228057 GTCAGCTGGTTTCCCTGGCAGGG + Intronic
922852530 1:228745930-228745952 TGCAGTTGGTCTCCCTGGAGGGG + Exonic
923656895 1:235924623-235924645 GGCCACTTGTCTTTCTGGAAGGG + Intergenic
924343589 1:243055327-243055349 GGCAGCAGCTCATCCTGGAGAGG + Intergenic
924753163 1:246916141-246916163 AGCAGTTGTTCTTCCTGGAAGGG - Exonic
924865719 1:247978028-247978050 GCCAGCTGGACTTCCTGGGTCGG + Intronic
1062985239 10:1762195-1762217 AGCTGCTGGTTTTCTTGGAAGGG - Intergenic
1063111594 10:3042799-3042821 GGAAGCAGCTCTTCCTGGCAAGG + Intergenic
1064331290 10:14396673-14396695 GCAAGCAGGTGTTCCTGGAAGGG - Intronic
1065229445 10:23582314-23582336 CACAGTTGGTCTTTCTGGAATGG - Intergenic
1065297711 10:24292430-24292452 GGCAAATGGCCTTCCTGTAAAGG - Intronic
1066045068 10:31587788-31587810 GCCAGCTGGGCTTCTTGGTAGGG - Intergenic
1066190704 10:33053209-33053231 GGCAACTGTTCTTCCTGGTAAGG - Intergenic
1067089876 10:43261147-43261169 CCCAGCTGTTCTTCATGGAAAGG - Intronic
1067561940 10:47310365-47310387 GGCAGCTCGTTGTCCTGGAGGGG - Exonic
1067900871 10:50240254-50240276 GGAAGCTGGAGTTGCTGGAAGGG - Intronic
1068368502 10:56083660-56083682 GCCAGCTGGACTTCCTGGGTTGG - Intergenic
1072176860 10:92933796-92933818 GGCAGCTGGACATTCTGGTAGGG + Intronic
1073549348 10:104382966-104382988 GGCAGCTGGCATCCCTGGATTGG - Intronic
1073941703 10:108706670-108706692 TACAGATGGTCTTCCTGGAGTGG + Intergenic
1075584254 10:123645681-123645703 GGGAGCTGGTCCTTTTGGAATGG - Intergenic
1075669745 10:124256286-124256308 AGCAGCTGGTCTCCCCGGGAAGG + Intergenic
1075721985 10:124592770-124592792 GGCAGCTTGTCTCCCTGGCCTGG + Intronic
1077332935 11:1991255-1991277 TGCAGGTGGGCTTCCAGGAAGGG + Intergenic
1077516848 11:3007255-3007277 GGAAGCAGTTCTTCCAGGAAAGG + Intronic
1078582460 11:12549092-12549114 GGCAGATGGTCTTCCAGAAGGGG + Intergenic
1079077728 11:17394332-17394354 GGCAGCTGTTCTGCCTGGCCCGG - Exonic
1081204961 11:40264224-40264246 GGTAGCGTTTCTTCCTGGAAAGG - Intronic
1081578483 11:44334645-44334667 TGCAGCTGCTCCTCCTGGGAGGG + Intergenic
1082013437 11:47466913-47466935 GGCTGCTGAATTTCCTGGAAGGG - Intronic
1083471261 11:62885587-62885609 TGCAGCTGCCCTTCCTGGACAGG + Exonic
1083554407 11:63614357-63614379 TGGATCGGGTCTTCCTGGAAGGG - Exonic
1083729976 11:64647666-64647688 GACAGCTGGTTTCCCTGGAATGG - Intronic
1085755340 11:79197181-79197203 AGCAGTTCGTCTTGCTGGAAGGG + Intronic
1087538042 11:99477649-99477671 GGCCCCTGATCTTCCTTGAAGGG - Intronic
1089981564 11:122777046-122777068 GGCAGGGGGTCATCCAGGAAGGG - Exonic
1202815918 11_KI270721v1_random:46431-46453 TGCAGGTGGGCTTCCAGGAAGGG + Intergenic
1092770900 12:11895595-11895617 GGCAGCTGCTCAGCTTGGAATGG - Intergenic
1096519986 12:52179536-52179558 GGCAGCTGGGACTGCTGGAAAGG + Intronic
1097276906 12:57819916-57819938 GGCAGCTCACATTCCTGGAAAGG + Exonic
1101445466 12:104734075-104734097 GGAAGCTGGCCCTCCTGGCAGGG - Intronic
1101986395 12:109450736-109450758 GTCAGATGGCCTTCCTGGAGTGG + Exonic
1102586980 12:113930472-113930494 GGCAGCTGATCTGCCAGGGAAGG - Intronic
1103236158 12:119374524-119374546 GGGTGGTGGTGTTCCTGGAAAGG + Intronic
1104018460 12:124975876-124975898 TGCAGCTGCTCTCCCTCGAAAGG + Intronic
1104126174 12:125848292-125848314 GGCAACTGCTCTCTCTGGAAGGG + Intergenic
1104253169 12:127115909-127115931 AGCAGCTGCTCCTCTTGGAAAGG + Intergenic
1104604871 12:130180512-130180534 GACAGATGGTTTCCCTGGAAAGG - Intergenic
1105503175 13:20989473-20989495 GGCAACTGGTCCTGCTGGCAGGG - Intronic
1105665572 13:22552307-22552329 GGCACCTGGTGCTCCAGGAATGG + Intergenic
1105783180 13:23721914-23721936 GGTAGCTCGTCTTGCAGGAATGG + Intergenic
1112111670 13:96306610-96306632 TTCTTCTGGTCTTCCTGGAAAGG - Intronic
1113204277 13:107897597-107897619 GCCAGCTGGACTTCCTGGGTCGG - Intergenic
1113615705 13:111679055-111679077 AGCAGGTGGGCTTCCTGGCACGG - Intergenic
1113621173 13:111763957-111763979 AGCAGGTGGGCTTCCTGGCACGG - Intergenic
1113793756 13:113044921-113044943 GTCAGCTGGTCACCCAGGAAAGG + Intronic
1114856226 14:26448043-26448065 TGCAGCTGGTGTTCCAGTAATGG + Exonic
1118332660 14:64825914-64825936 GGCAGCAGCTCTGCCAGGAATGG + Intronic
1118982884 14:70730513-70730535 GGCAGCGGCCCTGCCTGGAACGG + Exonic
1120103806 14:80472524-80472546 GCCAGCTGGACTTCCTGGGTAGG - Intergenic
1120812990 14:88824374-88824396 GGCAGCTGCGCCTCCTGGGAGGG + Intronic
1121144048 14:91568172-91568194 GCCAGCTGGACTTCCTGGGTCGG - Intergenic
1121208462 14:92188555-92188577 GGCATATGCGCTTCCTGGAATGG - Intergenic
1122219961 14:100231564-100231586 GGCAGCTGGTCTACCTTCCAAGG + Intergenic
1122363019 14:101178605-101178627 GGCAGTTGGTCTCCCTGCACAGG - Intergenic
1122634747 14:103124651-103124673 GGGAGCTGGTCTGTCTGGCAGGG - Intronic
1123219514 14:106843005-106843027 GGCAGCTGCCCTTACGGGAAGGG - Intergenic
1125359267 15:38848522-38848544 GGTAGATGGTCTCCCTTGAAAGG - Intergenic
1126063476 15:44806496-44806518 GGTAGCAGGTGTTCCTTGAAAGG - Intergenic
1127051618 15:55089820-55089842 GGAAGCTGGCTGTCCTGGAATGG - Intergenic
1128943698 15:71807891-71807913 GGCAGCTGCCCCTCCTGGGAGGG + Intronic
1129409490 15:75341264-75341286 GGCAGATGGGCTTCCAGGACTGG + Intronic
1131367048 15:91850505-91850527 GCCAGCTGGACTTCCTGGGTCGG - Intergenic
1131846573 15:96495323-96495345 AGCAGCTGGTCTTCCTGGGCTGG - Intergenic
1132400868 15:101504446-101504468 GCCAGCTGGTATTTCAGGAAGGG + Intronic
1132688013 16:1170332-1170354 GGCAGCAGGGCTCCCTGGGACGG + Intronic
1132951724 16:2566616-2566638 GCCAGCAGGTCTTCCTGGGGGGG + Intronic
1132962626 16:2633554-2633576 GCCAGCAGGTCTTCCTGGGGGGG - Intergenic
1133176757 16:4021310-4021332 GGCAGCAGGTGTTTCAGGAAAGG + Intronic
1133408861 16:5551309-5551331 GGCAGCTGGTCTGCCCAGAGTGG + Intergenic
1134768472 16:16783094-16783116 GGCAGCTAGGTTACCTGGAAAGG + Intergenic
1136379945 16:29888560-29888582 GGCACCCGGCCATCCTGGAACGG - Exonic
1136402983 16:30028594-30028616 GGCAGCGGCCCTTCCTGGAAGGG - Intronic
1141063683 16:80897514-80897536 GGTTTCTGGCCTTCCTGGAAGGG - Intergenic
1144023269 17:11255696-11255718 GGCCGTGGGTCATCCTGGAAGGG - Intronic
1146901916 17:36594142-36594164 GGCAGCTGGGCTTGGTTGAAAGG + Intronic
1149097546 17:52861829-52861851 GCCAGCTGGACTTCCTGGGTTGG + Intergenic
1149492663 17:57096392-57096414 GACAGCTGCTCTACGTGGAAGGG + Intronic
1150126331 17:62637668-62637690 GGAAGCTGGTGCTCCTGGCAGGG - Intronic
1150602868 17:66665590-66665612 TGCTGCTGGTCTACCTGGAGTGG + Intronic
1151625564 17:75273345-75273367 GGCAGCTGGCCTGCAGGGAAGGG + Exonic
1151625680 17:75274160-75274182 GGCAGCCGTTCTTCCTGGGCAGG - Intronic
1152026356 17:77811959-77811981 GGCAGATGGTCTTCGTGCATGGG - Intergenic
1152844939 17:82593876-82593898 AGCTGCTGCTCTGCCTGGAAAGG - Intronic
1158048639 18:53188318-53188340 GGCAGTTTCTCTTCCTGAAATGG + Intronic
1160018143 18:75159414-75159436 GGCAGCTTGTCCTCCAGAAAGGG - Intergenic
1160837729 19:1132537-1132559 AGCAGCTGGTCCCCGTGGAACGG - Intronic
1163683625 19:18697703-18697725 GGCATCTGGTGTATCTGGAATGG + Intronic
1163838305 19:19589858-19589880 TGATGCTGGTCTTCCAGGAAAGG + Intronic
1164245188 19:23422151-23422173 GGGAGCTGGGCTTCATGGAGAGG - Intergenic
1164308876 19:24029386-24029408 GGGAGCTGGGCTTCATGGAGAGG + Intergenic
1165091153 19:33389027-33389049 AGCAGCTGGGCTTCCTGGGGAGG - Intronic
1165948162 19:39457873-39457895 GGGAGCTGGTCTCTCTGGGAAGG - Intronic
1167421083 19:49403760-49403782 GGCAGCAGGCCTTCCTGGTGGGG - Intronic
925008848 2:467327-467349 GGCAGGTGGGCTGCCAGGAAGGG - Intergenic
925168061 2:1731323-1731345 TGCATCTGGGCTTCCTGGACAGG + Intronic
927824750 2:26300462-26300484 GCCAGCTTCTCTTCCTGTAAGGG - Intergenic
929130266 2:38561020-38561042 GGCAGCAGGTCCTCCTAGAGGGG - Intergenic
929539497 2:42809385-42809407 GGAAGCTGGTCCTCCAGGGAAGG - Intergenic
931333313 2:61311783-61311805 GCCAGCTGGACTTCCTGACAAGG - Exonic
932301222 2:70668275-70668297 GGGAGCTGGCATTCCTGGAAGGG - Intronic
932432245 2:71682999-71683021 GGCAGGGGGACTTTCTGGAAGGG + Intronic
934612620 2:95752383-95752405 TGCAGCTGCTCCTCCGGGAATGG + Intergenic
934648295 2:96072040-96072062 TGCAGCTGCTCCTCCGGGAATGG - Intergenic
936065972 2:109332422-109332444 GGGTGCAGGTCTTCCTGGACGGG + Intronic
937624347 2:124026076-124026098 GGGAGCTGAGCTTCCTGGGATGG + Intronic
937906675 2:127055905-127055927 GGCAACTGGTCTTCCCGGTCTGG - Intronic
938093409 2:128447531-128447553 GGGAGATGGTCTGCCTGGACAGG - Intergenic
939814881 2:146881687-146881709 GCCAGCTGGACTTCCTGGGTCGG - Intergenic
939956349 2:148530611-148530633 GGTAGCTGAGCTTCCTGGGATGG + Intergenic
940995073 2:160140417-160140439 GGCGGCTGCTCTTACTGGAGGGG + Intronic
941119031 2:161507303-161507325 AGCAGTTGTTCTTCCTGGAAGGG - Intronic
945841412 2:214891984-214892006 ATCAGCTGGTCTTCCTGTATGGG + Intergenic
945947997 2:216013121-216013143 GGGAGGTGGGCTTGCTGGAAGGG - Intronic
946403781 2:219482480-219482502 GGCAGCTGGTTTACCAGGACAGG + Intronic
946410157 2:219511693-219511715 GGCAGCTGGTCCCCCGGGAGTGG + Intergenic
947565876 2:231192665-231192687 GGCCGCTGGTCTGCCTGGGTGGG + Intergenic
948596649 2:239083711-239083733 GGCACCTGGTCCTGCTGGAATGG - Intronic
948602811 2:239116889-239116911 GTCAGCTGATCTTCCTGATAGGG + Intronic
948763268 2:240205564-240205586 AGCAGCTGGTCCTCCTGGGAGGG - Intergenic
1171316795 20:24202505-24202527 GGCAGGTCTTCTTCCTGGGAAGG - Intergenic
1172281956 20:33714181-33714203 GGAAGCTGGGCTTCCTTGGAGGG + Intronic
1173416745 20:42863756-42863778 GAAAGCTGGTCTTGCTGTAAAGG + Intronic
1173849393 20:46208329-46208351 GGCAGCTGGGGTCCCTGGAAGGG - Intronic
1175241344 20:57551731-57551753 AGGAGCTGGTCTTCCTGGCTGGG + Intergenic
1176346653 21:5754570-5754592 GCCAGCTCCTCTTCCCGGAAGGG + Intergenic
1176353467 21:5875154-5875176 GCCAGCTCCTCTTCCCGGAAGGG + Intergenic
1176498174 21:7569885-7569907 GCCAGCTCCTCTTCCCGGAAGGG - Intergenic
1176540974 21:8152640-8152662 GCCAGCTCCTCTTCCCGGAAGGG + Intergenic
1176559925 21:8335685-8335707 GCCAGCTCCTCTTCCCGGAAGGG + Intergenic
1176920799 21:14685040-14685062 GGCAGATGGTGACCCTGGAATGG - Intergenic
1178304122 21:31476405-31476427 TGCAGATGTTCTTCCTGAAATGG - Intronic
1179219766 21:39395839-39395861 TGCAGCCTGTCTTCCTGGACAGG + Intronic
1180051683 21:45334587-45334609 TGCATCTGGTCTTCCTGGTGTGG + Intergenic
1180073744 21:45451356-45451378 GTCAGCTTGGCTTCCAGGAAGGG + Intronic
1180215048 21:46318402-46318424 GCCAGCTGGGCTTCATGGGAAGG + Intronic
1180796206 22:18606983-18607005 AGGAGCTGGTCTTCCAGAAAAGG - Exonic
1180955594 22:19739850-19739872 GGCTGGTGGTCTGCCTGGGAGGG + Intergenic
1181225516 22:21388288-21388310 AGGAGCTGGTCTTCCAGAAAAGG + Exonic
1181253117 22:21546525-21546547 AGGAGCTGGTCTTCCAGAAAAGG - Exonic
1183110157 22:35642846-35642868 GGCAGCTGGTCTTCCAAGGTGGG - Intergenic
1184379900 22:44138691-44138713 GACAGGAGGGCTTCCTGGAAGGG - Intronic
1184973235 22:48042873-48042895 GGCAGCTGCTCTACCTGGCATGG - Intergenic
1203245913 22_KI270733v1_random:69059-69081 GCCAGCTCCTCTTCCCGGAAGGG + Intergenic
949129882 3:487142-487164 GTCAGCTGGTCTGGCTGAAATGG - Intergenic
950028767 3:9838146-9838168 GGCAGCTGGGCAGCCTGGGAGGG + Exonic
952395896 3:32920625-32920647 GGCAACTGGTCTTCAAAGAATGG - Intergenic
952425516 3:33170695-33170717 GGCAGCTGGCCTTTCCAGAAGGG - Intronic
952523881 3:34189406-34189428 GGTAGCAGGTCTTCCTTGAAAGG + Intergenic
953037336 3:39224521-39224543 GGGTGGTGGTGTTCCTGGAAAGG + Intergenic
954002315 3:47567240-47567262 GGCAGCAGGTCTGCCAGGACGGG - Intronic
954422688 3:50426939-50426961 GGGAGCTGGTCTCCCTGGGAAGG - Intronic
954616095 3:51969435-51969457 GGCTGCTGGACTTCCTGCAGGGG - Exonic
954701355 3:52452500-52452522 GTCAGCTGCTCTACCTAGAAAGG + Exonic
955101961 3:55859202-55859224 GGCTACTGGACTTCCTGGATGGG + Intronic
956788376 3:72661338-72661360 GGCAGCTGTGCTAGCTGGAAAGG + Intergenic
957291720 3:78285584-78285606 GGCATCTGCTCTCCCTGAAAAGG + Intergenic
959486801 3:106936170-106936192 TGCAGGTGGTCTCCCTGGAATGG - Intergenic
959689331 3:109181525-109181547 GGAAGCTGGTTTTTGTGGAATGG - Intergenic
959922451 3:111883722-111883744 GGAAGCAGGTGTTCCTCGAAGGG + Intronic
961345065 3:126258963-126258985 GGCAGCTGCACTTCCTGTGATGG + Intergenic
966269546 3:178088290-178088312 GAAAGCTGGTCTTCAGGGAAAGG + Intergenic
967294429 3:187951259-187951281 GCCACTTGCTCTTCCTGGAAGGG + Intergenic
968548888 4:1212514-1212536 GACTGCTGGTCCTCCTGGAGAGG - Intronic
968903511 4:3441803-3441825 GACAGCTGGGCTTCCAGGTAGGG + Intergenic
969578941 4:8052679-8052701 GGGAGCTGGCCTTCCAGGAAGGG + Intronic
970208983 4:13687702-13687724 GGCAGGTTGTCTTCCTGGCTGGG + Intergenic
970693069 4:18642229-18642251 GGCAGCTGGTTTTGCTCTAAAGG - Intergenic
972161974 4:36238128-36238150 GGGAACTGGGCTTCCTGTAAGGG - Intronic
972389669 4:38602798-38602820 GACACCTGGACTTCCTGGGAGGG + Intergenic
973534634 4:51868231-51868253 GGCTGCAGCTGTTCCTGGAAGGG + Intronic
973706630 4:53587794-53587816 AACAGCGGGTCTTCCTGGAGCGG - Intronic
985423516 4:189807026-189807048 GCCAGCTGGGCTTCCGGGTAGGG - Intergenic
985917407 5:2933230-2933252 TGAAACTTGTCTTCCTGGAAGGG - Intergenic
986079652 5:4376742-4376764 TGCAGCTGTTCATCCTGTAAAGG + Intergenic
986578494 5:9237219-9237241 GACACATAGTCTTCCTGGAAAGG + Intronic
987066701 5:14296996-14297018 GGCATCTGGGCTTCTTAGAAGGG + Intronic
990506409 5:56449631-56449653 GGCACCTTTTCTTCCTGGAATGG - Intergenic
990698209 5:58446421-58446443 GCCAGCTGGACTTCCTGGGTCGG - Intergenic
994511261 5:100706807-100706829 TGCAGTTGGTCTTCCTTAAATGG - Intergenic
995189975 5:109309821-109309843 TGCAGCTGTTCTTCCTGGGATGG - Intergenic
996415879 5:123209504-123209526 GGCAGCAGGTCATCCTGAAGAGG - Intergenic
996690416 5:126334194-126334216 CCCAGCTGATCTTCCTGGAGTGG - Intergenic
997337301 5:133117363-133117385 AGCAGCTGGCCTGCCAGGAAGGG + Intergenic
998394487 5:141809904-141809926 GCCAGCTGGTCAGCCTGGGATGG + Intergenic
999231739 5:150065776-150065798 GGCAGCTGAATTTCCTGGACAGG + Intronic
1000342704 5:160289730-160289752 GGCAGCAGGGCTGCCTGGACAGG + Intronic
1001543699 5:172557067-172557089 GGCAGCAGGTCTTCCACGATGGG + Intergenic
1001665931 5:173433779-173433801 GGCAGCTGCTTGGCCTGGAATGG + Intergenic
1002212144 5:177605373-177605395 GGCAGAGGGCCTTCCTGGCAGGG - Intronic
1002321920 5:178381415-178381437 AGCAGCTGGTCCTGCTGGCATGG - Intronic
1002948480 6:1785466-1785488 GGCAGCTGTACTTGTTGGAAAGG + Intronic
1003080428 6:3016977-3016999 CGCAGCTGGTCTACCTGGAGTGG - Exonic
1004417376 6:15437104-15437126 GTCATCTTTTCTTCCTGGAAAGG + Intronic
1005583868 6:27257641-27257663 AGCAGCTTGACTTCCTGGACTGG + Intergenic
1005715079 6:28539434-28539456 GTCAGCTGGACTGCCTGGGATGG - Intergenic
1006588471 6:35135263-35135285 GGCAGCTGGCTTTCCTCCAAGGG - Intronic
1006832359 6:36976560-36976582 GGCAGCTGAGCTTCCTGGGATGG + Intronic
1006996594 6:38266978-38267000 GGCAGATGGCCTTGCTGGAGAGG - Intronic
1007029653 6:38616540-38616562 GCCAGCTGGACTTCCTGGGTCGG + Intronic
1007241993 6:40432846-40432868 GGCTGATGGTGTTCCTGGACAGG + Exonic
1009672958 6:66779951-66779973 GCCAGCTGGGCTTCTGGGAAGGG - Intergenic
1012984232 6:105857854-105857876 TGCAGCTGGCCAACCTGGAAAGG - Intergenic
1015274081 6:131366629-131366651 GGGAGCTGGTCTGCATGGAAGGG + Intergenic
1018469537 6:164083397-164083419 GGCAGGTGGTCCTCTTGGACAGG - Intergenic
1020209821 7:6150281-6150303 GGCAAACGGTCTTCCTGGAAAGG + Exonic
1022785149 7:33631227-33631249 GGCTGAGGGTCTCCCTGGAACGG - Intergenic
1023012648 7:35937677-35937699 GGCAGGAGGTCCCCCTGGAATGG + Intergenic
1023173882 7:37417177-37417199 GGCAGCTGTTATGCATGGAAAGG + Intronic
1026863313 7:73807906-73807928 GGCAGCTGGTGCTCGTGGACAGG + Intronic
1027257715 7:76441869-76441891 GGCCACTGATCTTCCTGGACAGG + Exonic
1027281133 7:76610166-76610188 GGCCACTGATCTTCCTGGACAGG - Exonic
1027790723 7:82636888-82636910 GCCAGCTGGACTTCCTGGTTGGG + Intergenic
1029536590 7:101160986-101161008 GGCAGCTTCTCTGCCTGGGAGGG + Exonic
1029710541 7:102296672-102296694 GACAGCTGGGATTCCTGGATTGG + Intronic
1029977429 7:104848152-104848174 GGCAGCTCATCTGGCTGGAAGGG + Intronic
1032057226 7:128693490-128693512 AGCAGGTGGACTTCCTGAAATGG + Intergenic
1032916972 7:136501929-136501951 GGTAGCTGGTTATACTGGAAAGG - Intergenic
1033309900 7:140253587-140253609 GCCAGCTGGTCTACCTAGAAGGG + Intergenic
1034474196 7:151273449-151273471 GGCAGCTAAGCTTCCTGGAGGGG - Intronic
1034672672 7:152870182-152870204 CACAGCGGGTCTGCCTGGAAGGG + Intergenic
1035731974 8:1859998-1860020 GGCGGCTGGTCCTCCTGGAATGG - Exonic
1036533978 8:9627172-9627194 GGCAGCTGGTGCTCCAGGGATGG + Intronic
1037662834 8:20941926-20941948 GGCAGCTGCTCTCCCTGGGTGGG + Intergenic
1039355454 8:36810397-36810419 GACATCTGGTCTCCCAGGAAAGG + Intronic
1039421663 8:37448510-37448532 GGCAGCAAGTCTTTCTGGAAGGG + Intergenic
1042051888 8:64718712-64718734 GGGACCTAGTCTGCCTGGAATGG - Intronic
1042225390 8:66511133-66511155 GGCAGCTGTCCTTCCTTGAAGGG + Intronic
1042267566 8:66925010-66925032 GGCAGCTTGTTTTCCTTAAAAGG - Intergenic
1042506351 8:69565067-69565089 GGCACTTGGTCTCCATGGAAGGG + Intronic
1044998205 8:97857075-97857097 AGCAGCTGCTCTTGCTGGTAAGG - Intergenic
1047260557 8:123255166-123255188 AGCAGCAGTTCTTCCTGGATTGG - Exonic
1049584329 8:143425914-143425936 GTCAGCTGCTCTTCCAGGATGGG + Intronic
1049625157 8:143616604-143616626 TGGAGCTGGACTTCCTGGAGAGG - Exonic
1049659301 8:143812616-143812638 GGCAGCTGGTGGTGCTGGAGGGG - Intronic
1049763595 8:144342509-144342531 GGCAGTTGGACCTCTTGGAAGGG - Intergenic
1052235069 9:26202760-26202782 TGAAGCTTGTTTTCCTGGAATGG + Intergenic
1054756625 9:68965311-68965333 GGCAGAGGGTGTCCCTGGAAAGG + Intronic
1055704852 9:78986923-78986945 GGCATATTGTCCTCCTGGAAAGG + Intergenic
1056958974 9:91105130-91105152 GGGAGTTGCTCTTCCTGGACAGG - Intergenic
1059366572 9:113791050-113791072 GGCAGATGGTCTTACCAGAAGGG - Intergenic
1060407576 9:123380487-123380509 GGCAGCTGGCCTTCCTGGGTTGG - Exonic
1060721589 9:125983242-125983264 GGCAGCCTGGCTTCCTGGGATGG - Intergenic
1061700972 9:132415387-132415409 GGCAGCTCGGCTTTCTGAAATGG - Intronic
1203787968 EBV:138329-138351 GGCAGCTCCTCTTCCGGGTATGG - Intergenic
1203462248 Un_GL000220v1:52131-52153 GCCAGCTCCTCTTCCCGGAAGGG + Intergenic
1185875653 X:3699822-3699844 GGGAGCTTGTCTTCCTTCAAAGG - Intronic
1187131883 X:16511219-16511241 GGCAGCTGGTTTTCTAGGGAAGG - Intergenic
1189614187 X:42767298-42767320 GGCAGCTTTACTTCCAGGAAAGG + Intergenic
1190342720 X:49310339-49310361 GCCAGCTTCTCTTCCTGTAAGGG - Intronic
1190929074 X:54933378-54933400 GGCAGTTTGACTTCTTGGAAAGG + Exonic
1191883435 X:65864616-65864638 GGCAGCTGGTGCTGATGGAAAGG + Intergenic
1192486420 X:71530906-71530928 GCCAGCTGGACTTCCTGGGTTGG - Intronic
1193160089 X:78217903-78217925 GGCAGGTGGTATTCATGTAAGGG - Intergenic
1193456660 X:81739476-81739498 GTCATCTGATCTTCCAGGAAGGG - Intergenic
1195781275 X:108467618-108467640 GGCATCTTGTGTTCCTGGATTGG - Intronic
1196419851 X:115510137-115510159 GCCAGCTGGACTTCCTGGGTCGG + Intergenic
1197412603 X:126138235-126138257 GGCAGCAGCTCTTCCTGTCAGGG - Intergenic
1197764521 X:130051256-130051278 GCCTGCTGGTCTTCCAGGAGAGG - Intronic
1197859775 X:130958076-130958098 TGCAGCAGGTTTTCCTGGAAGGG + Intergenic