ID: 902805313

View in Genome Browser
Species Human (GRCh38)
Location 1:18857660-18857682
Sequence AAGCAGATCCAGAATGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 346
Summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 309}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902805308_902805313 6 Left 902805308 1:18857631-18857653 CCTGGAGGGGCCACAGCATCATG 0: 1
1: 0
2: 3
3: 26
4: 278
Right 902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG 0: 1
1: 0
2: 3
3: 33
4: 309
902805302_902805313 26 Left 902805302 1:18857611-18857633 CCTATCACCTTCACTTCATACCT 0: 1
1: 0
2: 3
3: 13
4: 258
Right 902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG 0: 1
1: 0
2: 3
3: 33
4: 309
902805306_902805313 19 Left 902805306 1:18857618-18857640 CCTTCACTTCATACCTGGAGGGG 0: 1
1: 0
2: 1
3: 11
4: 125
Right 902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG 0: 1
1: 0
2: 3
3: 33
4: 309
902805311_902805313 -4 Left 902805311 1:18857641-18857663 CCACAGCATCATGAGGTGGAAGC 0: 1
1: 0
2: 3
3: 15
4: 183
Right 902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG 0: 1
1: 0
2: 3
3: 33
4: 309

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902805313 Original CRISPR AAGCAGATCCAGAATGAGGA AGG Intronic
901185289 1:7368958-7368980 AAACAGAAGCAGAAGGAGGAAGG - Intronic
901460265 1:9387104-9387126 AAGCAGATCTGCAATGGGGAGGG + Intergenic
901935125 1:12621460-12621482 AAGCAGAGCCTGATTCAGGAGGG - Intergenic
902805313 1:18857660-18857682 AAGCAGATCCAGAATGAGGAAGG + Intronic
904295762 1:29518859-29518881 AAGGAGAAGGAGAATGAGGAAGG - Intergenic
905170974 1:36109327-36109349 AGACAGAGCCAGAAGGAGGAGGG - Intronic
905385405 1:37600016-37600038 TAGCAGAGCCAGGGTGAGGAAGG + Intergenic
906115271 1:43352465-43352487 AAGCAGATCCTGTGGGAGGAGGG - Intronic
906507552 1:46391446-46391468 AAGCACTTACAGAATCAGGAAGG - Intergenic
906581835 1:46941344-46941366 CAGCAGAAGCAGAATGAGCAGGG + Exonic
906601882 1:47137553-47137575 CAGCAGAAGCAGAATGAGCAGGG - Exonic
907464614 1:54626791-54626813 CAGCAGTTCCAAAATGAGAATGG - Intronic
910152886 1:84174125-84174147 AAGCAGATGCCGAATCAGGGAGG - Intronic
911138211 1:94465987-94466009 GAGCAAATCCAGCATGATGAAGG - Intronic
911152394 1:94608158-94608180 AAAGAGATCCACAAAGAGGAAGG - Intergenic
911594944 1:99788831-99788853 GAGTAGAAACAGAATGAGGAGGG - Intergenic
912803897 1:112740986-112741008 AACCAAATCCAGTATGAGGAAGG + Intergenic
912822737 1:112880852-112880874 AAGCAGCTTCAGAGTGGGGAGGG + Intergenic
912939886 1:114035414-114035436 AAGAATATCCTGACTGAGGAAGG + Intergenic
913330100 1:117659946-117659968 AAGCAGATAAAGAATGCAGAAGG + Intergenic
914823281 1:151121861-151121883 AAGCAAGTCTAGAATGATGAGGG - Exonic
915536621 1:156540124-156540146 AAGCAGTTCTAGGGTGAGGAAGG + Intronic
915585399 1:156841352-156841374 AGGTAGATCAACAATGAGGAAGG + Intronic
915916254 1:159942643-159942665 AAGCAGTTACAGAATTAGAATGG + Intronic
916964005 1:169916584-169916606 ACGGAGACCCAGGATGAGGAGGG - Intergenic
919054000 1:192546127-192546149 GAGCAGATGCAGGCTGAGGAAGG + Intergenic
920532131 1:206710749-206710771 AAGCAGATCCAAACTTAGAAAGG + Intronic
922895529 1:229097177-229097199 AAGAAGAGCCAAAATCAGGAAGG + Intergenic
923718608 1:236448252-236448274 CAGCACAGCCAGAGTGAGGAAGG + Intronic
1062795885 10:344939-344961 CAGCAGATCCAGCCTGAGCAAGG + Intronic
1064897031 10:20248716-20248738 AAACAGATCCACAATGACCATGG + Intronic
1065736560 10:28758296-28758318 AAGTAGAGACAGAAGGAGGAAGG - Intergenic
1067150792 10:43731666-43731688 AAGCAGAAACAGAAGGAGGAAGG - Intergenic
1067382440 10:45787406-45787428 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1067890138 10:50127954-50127976 AAGCAGGTGCAGGATGAGGGGGG - Intronic
1070588571 10:77785105-77785127 AAGCAAGTCCAGAATCAGGGAGG - Intergenic
1071575244 10:86720824-86720846 AAGAAGATCCAGGAAGAAGACGG + Intronic
1071887718 10:89969094-89969116 GGGCAGCTCCAGAATGTGGATGG + Intergenic
1072247259 10:93554743-93554765 AAGCAGAGCCACAAGGAGAAGGG - Intergenic
1072395615 10:95037141-95037163 AAGCAGATCTGGTATGAGGGTGG + Exonic
1072478029 10:95782392-95782414 AGGTATGTCCAGAATGAGGAAGG + Intronic
1072753595 10:98001989-98002011 GAGCAGGGCAAGAATGAGGAAGG + Intronic
1073193503 10:101669192-101669214 AAGAGGATCCTAAATGAGGAGGG + Intronic
1073588637 10:104735095-104735117 AAGCACATCAAGAAAGAGAAGGG + Intronic
1076080261 10:127573733-127573755 ATGCAGATCCAGAATCAGAAAGG + Intergenic
1076150889 10:128161225-128161247 AAGGAAAGCGAGAATGAGGAAGG - Intergenic
1076556973 10:131331411-131331433 AACCAAATCCAGGAAGAGGAAGG - Intergenic
1078744071 11:14094706-14094728 AAGCAGTTACAAAATGAGGAAGG + Intronic
1078903912 11:15666727-15666749 AAGCAGATTAAAAATGAGAATGG - Intergenic
1080688449 11:34535377-34535399 CAGCAAATCCAGAATGTTGAAGG - Intergenic
1081357293 11:42126730-42126752 AAGCAGATTCAGACTGACGATGG - Intergenic
1081654624 11:44849289-44849311 AAGCAGGACCTGAGTGAGGATGG + Intronic
1082179769 11:49103314-49103336 AAGCAGAACCAGTAGGAGGGCGG - Intergenic
1083367547 11:62150574-62150596 AGGCAGAGCTAGAATGGGGAAGG + Intronic
1085008954 11:73122471-73122493 GAGCAGATCAAGAAAGAAGATGG - Intronic
1085015907 11:73173925-73173947 AATCAGATCCAGGATGGGGCGGG + Intergenic
1086527300 11:87742836-87742858 GAGCTTATCCAAAATGAGGAGGG + Intergenic
1086591824 11:88524118-88524140 AAACAGTTCCAGAATGTTGAAGG - Intronic
1086604463 11:88679897-88679919 AAGAAGATGAAGAATGAGGAAGG - Intronic
1087624940 11:100585477-100585499 AAGCAGAGGCAGAGAGAGGATGG - Intergenic
1087749991 11:101996742-101996764 AAACAGATTCAGGATGAAGAGGG + Intronic
1087852705 11:103050949-103050971 AATCAGACCCAGAATAAGGGGGG + Intergenic
1088996148 11:114999042-114999064 ATGCAGAGCCAGGAGGAGGAAGG + Intergenic
1089688933 11:120174128-120174150 GAGCAGAGCCAAAATGAAGAGGG - Intronic
1090894160 11:130954625-130954647 ATTCTGATACAGAATGAGGATGG - Intergenic
1091637234 12:2206230-2206252 AAGGAGATCCAGAGGGAAGAAGG + Intronic
1091705962 12:2693551-2693573 AGGCTGCTCCAGAGTGAGGAAGG - Intronic
1092926860 12:13279354-13279376 AGGCAGATGGAGAAAGAGGAAGG - Intergenic
1094689654 12:32756089-32756111 AAGCAGATCCACACTGCTGATGG - Intergenic
1095926620 12:47585439-47585461 AAGAAGATCCAAAGAGAGGAGGG + Intergenic
1096087248 12:48874013-48874035 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1096123130 12:49101505-49101527 GAGCAGCTCCAGGATGTGGATGG + Exonic
1096863114 12:54544323-54544345 ATGCAGATGCAGATGGAGGAGGG - Exonic
1097542263 12:60955965-60955987 AAGCCGACCCAGTGTGAGGAGGG + Intergenic
1100029665 12:90170705-90170727 TAGCAAATGCAGAATGAGAAAGG + Intergenic
1100471365 12:94896319-94896341 AAGCAGAACCAGAATAGGGAAGG + Intergenic
1101023684 12:100579202-100579224 TAGCAAATCCAGAAAGGGGATGG - Intronic
1101305484 12:103523834-103523856 AAACAGATTCAGAATGTGTAGGG + Intergenic
1104081630 12:125434886-125434908 AAGAAGTTTCAGCATGAGGAGGG - Intronic
1104277854 12:127346449-127346471 AAACAGATGAAGAAGGAGGAAGG + Intergenic
1104812850 12:131628889-131628911 CAGCAGGTGCAGAGTGAGGAGGG - Intergenic
1106132350 13:26950898-26950920 AAGCACTTCTAGAATGAGGTAGG + Intergenic
1106388678 13:29314072-29314094 AAGCAGACCAAGAAAGAGGAAGG + Intronic
1107566351 13:41609277-41609299 AGGCATATGCAGAATGAGGTCGG - Intronic
1107742120 13:43461724-43461746 AAGCAGTTTGAGAATGAGTAGGG + Intronic
1108071592 13:46634501-46634523 AGGCACAGCCTGAATGAGGAAGG - Intronic
1108807476 13:54176715-54176737 ATGCAGACCCAAAAGGAGGAAGG + Intergenic
1109309379 13:60673855-60673877 AAACATATCCAGAATAAGGTGGG - Intergenic
1110479933 13:75962172-75962194 TAGCAGCTCCATAATGTGGAAGG + Intergenic
1111342688 13:86908926-86908948 ATGCAGATTCAGTATTAGGAAGG + Intergenic
1112136434 13:96583582-96583604 AAGCACATTCAAAATGAGGTTGG - Intronic
1112383761 13:98918793-98918815 AAGTAGAACAAGAAAGAGGAAGG + Intronic
1112555614 13:100465875-100465897 AAGCAAATCCAGTATCAGGACGG - Intronic
1112916996 13:104564068-104564090 ATGCACATCCAGATTGAGGCCGG + Intergenic
1113935556 13:113993170-113993192 AAGCAGACATAGAATGAGCAGGG - Intronic
1115426156 14:33262193-33262215 TACCAGATCTAGAATGATGAAGG - Intronic
1116773260 14:49151399-49151421 AAGCAGCTGGAGAAGGAGGAAGG - Intergenic
1117155372 14:52934478-52934500 AAGTTGATCCAGACTTAGGAAGG - Intronic
1117784173 14:59265466-59265488 AAGGAGATCCATTATGAAGAAGG + Intronic
1118381226 14:65219196-65219218 AAATAGAGCCAGAAGGAGGAAGG - Intergenic
1118433178 14:65742879-65742901 CAACAGATTCAGAATGAGAATGG + Exonic
1118614793 14:67567896-67567918 AAACAGATCCAGAAGGTGCAGGG + Intronic
1121456404 14:94041542-94041564 AAGAAGATGCAGGCTGAGGAGGG - Intronic
1121854470 14:97254204-97254226 AAGGAGACACAGAAGGAGGAAGG - Intergenic
1122981822 14:105195476-105195498 AAGGAAGTCCAGAAGGAGGAGGG + Intergenic
1124791453 15:32731075-32731097 AGGCACATCCGGAAGGAGGAAGG + Exonic
1125895482 15:43298322-43298344 CAGCAGGGCCAGGATGAGGAGGG + Intronic
1126325851 15:47476577-47476599 AAGGAGATAGAGCATGAGGAAGG - Intronic
1126519447 15:49574697-49574719 CAGAAGATCCAGAATTAGAAAGG - Intronic
1128745584 15:70111829-70111851 ACGCAGATCCAGACTGCGGGGGG + Intergenic
1129085717 15:73088906-73088928 AAGAAGATTCAGAAAGAGTAAGG + Intronic
1130745919 15:86653700-86653722 CAGCATATCAAGTATGAGGAAGG + Intronic
1131063905 15:89421218-89421240 AAGCAGAGCCAGACTGAGTTTGG - Intergenic
1131670384 15:94613653-94613675 AGGCAGAACCAGAGTGAGAAAGG - Intergenic
1132057798 15:98665339-98665361 AGGCAGATGCAGAGTCAGGAGGG - Intronic
1132976535 16:2713893-2713915 CAGCAGACCCAGAAGGAAGAGGG - Intronic
1134023204 16:10935879-10935901 GAGCTGATCCAGACTGAAGAAGG + Intronic
1134125334 16:11612425-11612447 AGGCAGGTGAAGAATGAGGAAGG + Intronic
1134430014 16:14194748-14194770 AAGCAGAGCCAGAATTAAAAAGG - Intronic
1136603873 16:31318090-31318112 AAACAGATCTATAATGAGTAAGG - Intronic
1137914234 16:52411399-52411421 AAATAGATTTAGAATGAGGAAGG - Intergenic
1138420271 16:56894537-56894559 AAGGAGATAGGGAATGAGGAGGG - Exonic
1142611691 17:1111930-1111952 AAGCTGTTTCAGAAGGAGGAAGG - Intronic
1142933521 17:3308619-3308641 AAGCAGATTGAGATTGAAGAAGG + Intergenic
1143382647 17:6506179-6506201 AACCAGCTGCATAATGAGGAAGG + Intronic
1143852952 17:9826215-9826237 CAGCAGGACCAGAGTGAGGAAGG - Exonic
1146684401 17:34831249-34831271 CAGAAGATCCAGAAAGAGAATGG + Intergenic
1147000306 17:37358046-37358068 AAGTAGAAACAGAATCAGGAAGG + Intronic
1147177071 17:38662569-38662591 GATCAGATACAGGATGAGGAAGG - Intergenic
1147260749 17:39208708-39208730 AGGGAGATGCAGAAAGAGGAGGG - Intergenic
1149282576 17:55124484-55124506 AAGCAGATCCATTGTGAGGCTGG - Intronic
1149585474 17:57783326-57783348 ACTCTGATGCAGAATGAGGAAGG + Intergenic
1150206086 17:63409052-63409074 AAACAGATCCAGAATATGAAAGG + Intronic
1150973363 17:70056100-70056122 AAACAGAATCAGACTGAGGAAGG + Intronic
1153753138 18:8253970-8253992 AAGGTGATCAAGAATGGGGAGGG - Intronic
1154341471 18:13505993-13506015 AAGTGGATCCACACTGAGGAGGG - Intronic
1154957757 18:21276065-21276087 AAACAGAATGAGAATGAGGAAGG - Intronic
1155780566 18:29827604-29827626 AAGCAGATCCAAAATGACCAGGG + Intergenic
1156126542 18:33912221-33912243 AAAAAGATTGAGAATGAGGAAGG - Intronic
1158521808 18:58177289-58177311 AAGAAGCTCAAGTATGAGGAAGG + Intronic
1160099646 18:75908134-75908156 AAGCCGATTCAAAATGTGGAAGG + Intergenic
1160415126 18:78704547-78704569 AGGCAGATCCAGACTGAAGCTGG + Intergenic
1160475677 18:79184455-79184477 AAGCAGAGCGAGGATGAGAAAGG - Intronic
1161509768 19:4663828-4663850 AAGCCTGTGCAGAATGAGGATGG - Intronic
1161527318 19:4764574-4764596 GAGCAGAGCCTGAATGAGCAAGG + Intergenic
1161801245 19:6417762-6417784 AAGAAGATCCAGAATGATGCTGG - Exonic
1162657389 19:12141179-12141201 GAGCAGATCCAGAAAGAGTGTGG - Intronic
1163902543 19:20117455-20117477 CAGCAGAGCCAGAAGAAGGAAGG - Intronic
1163929184 19:20372308-20372330 AAGTACTTACAGAATGAGGAAGG + Intergenic
1165068505 19:33242048-33242070 ATACAGACCCAGACTGAGGACGG + Intergenic
1165800098 19:38544015-38544037 CAGCCAATCCAGAAAGAGGATGG - Intronic
1165931639 19:39362924-39362946 AAGCAGAGCCTGAAAGTGGAGGG - Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1167204950 19:48095164-48095186 AAGCAGATTCAGAATGTGTTTGG - Intronic
1167906758 19:52666981-52667003 AAGTAGTTACAGAATCAGGAAGG + Intronic
925251313 2:2441260-2441282 AAGGAGACCCAGAATGTGGGTGG - Intergenic
926903536 2:17784558-17784580 TCCCAGTTCCAGAATGAGGAAGG + Exonic
926920084 2:17931630-17931652 TCGGAGTTCCAGAATGAGGATGG + Exonic
927534663 2:23845874-23845896 AATAAGATCCAGCATGAGGTGGG - Intronic
927534730 2:23846416-23846438 AATAAGATCCAGCATGAGGTGGG - Intronic
927534797 2:23846958-23846980 AATAAGATCCAGCATGAGGTGGG - Intronic
927773078 2:25880491-25880513 AAGGAAATCCAGAAGGAGGGTGG - Intergenic
929021621 2:37558947-37558969 AAGCAGCTCCCAGATGAGGAAGG + Intergenic
929497028 2:42454061-42454083 AATCAGAACCACAATGAGGATGG + Intronic
930040070 2:47115349-47115371 GAGCAGATCCAGAAAGAGGAAGG - Intronic
930515264 2:52399755-52399777 AATTAGATCCAGAAGGAGGAAGG - Intergenic
932118181 2:69072857-69072879 AAGCAACTCCAGCATGAAGAAGG - Intronic
932378120 2:71256187-71256209 GAGAAGATACAGAATGAGAAGGG + Intergenic
932772526 2:74508340-74508362 GAGCAGATGCCGAAGGAGGAGGG + Exonic
933860527 2:86462328-86462350 AAACATATTCAGAATAAGGAAGG + Intronic
935948119 2:108304407-108304429 AAGCAGAGACAGAAAGAAGAGGG + Intronic
936958679 2:118049891-118049913 AAGCAGAAAGAGAATGAGTATGG - Intergenic
937040622 2:118817863-118817885 AAGTAGTTCCAGAATGAAAACGG + Intergenic
937343950 2:121111274-121111296 AAACACATCCAGCATCAGGATGG - Intergenic
938765490 2:134458377-134458399 AAGCAGGTACAGAATGATGGTGG - Intronic
938926482 2:136047850-136047872 AAGCAGATGGAGAAAGAGGTGGG + Intergenic
940545974 2:155085858-155085880 ATGCAGACTCAGAAGGAGGAGGG + Intergenic
940579185 2:155555100-155555122 AAGTAGACCCAAAAAGAGGATGG + Intergenic
941965473 2:171296354-171296376 GAGCAGATCCTGAATGATCAAGG + Intergenic
942791356 2:179765114-179765136 AAGCAGAACCAGTAGGAGAAAGG - Intronic
943562881 2:189484178-189484200 AGTCAGTTCCAGGATGAGGAAGG - Intergenic
946358958 2:219207391-219207413 AAGCAGATCCACAGTGATGCTGG - Exonic
947062231 2:226179804-226179826 AAGCAGATCCAAACTGAGAAGGG + Intergenic
947556101 2:231094608-231094630 TAGTAAATCCAGAATGAGTAAGG + Intronic
947708226 2:232293493-232293515 AAGCAGGTGGAGCATGAGGAAGG + Intronic
1168832121 20:851784-851806 AGGCAGATACAGGATGAGGTGGG - Intronic
1169781109 20:9311658-9311680 AAACAGCTCCAGGATGAGGAGGG - Intronic
1169817585 20:9674133-9674155 CAGCAGAAACAGAATGAGAATGG + Intronic
1170182853 20:13552673-13552695 AAGCTGATCCAAAATTAGAAAGG + Intronic
1170322348 20:15114220-15114242 AACCTGACCCAGAATGAGCAGGG + Intronic
1170345745 20:15384917-15384939 AAGCAGAGCCAGATTAAGGAGGG - Intronic
1170524208 20:17221444-17221466 AAGCAGTGGCAGACTGAGGATGG + Intergenic
1172194276 20:33081514-33081536 AAGCAGTGCCAGCATGTGGATGG + Exonic
1174030473 20:47620562-47620584 AGGCAGAGCAAGGATGAGGAAGG - Intronic
1174132287 20:48354231-48354253 ATGCACATCCAGAGTGAGTAAGG - Intergenic
1174584699 20:51599093-51599115 CAGCAGAAGCAGAATGAAGATGG - Exonic
1175055170 20:56191305-56191327 AGGCAGAGCCAGCAGGAGGACGG + Intergenic
1175950616 20:62581351-62581373 ATGCAGGTCCAGCATGAGGTGGG - Intergenic
1176958832 21:15136922-15136944 AGACAGCTCAAGAATGAGGATGG + Intergenic
1177698067 21:24599143-24599165 AAGCAGGCACAGAATGTGGAAGG + Intergenic
1178910766 21:36671564-36671586 AAGCTGAGCCTGAAAGAGGATGG + Intergenic
1179540349 21:42079585-42079607 GGGCAGATCTAGAAGGAGGAAGG + Intronic
1181434056 22:22900170-22900192 ATCCAGACCCAGAATGAGGTAGG + Intergenic
1181434994 22:22905536-22905558 ATCCAGACCCAGAATGAGGTAGG + Intergenic
1183814148 22:40285151-40285173 GAGCAGATCCAGGACAAGGAAGG + Intronic
949242711 3:1890933-1890955 AAGAAGATGGAGAAGGAGGAGGG - Intergenic
949262526 3:2119072-2119094 AAGCAGATCCATAATGTGGTGGG + Intronic
949386508 3:3508428-3508450 AAAAATATACAGAATGAGGAAGG + Intergenic
950157975 3:10738283-10738305 GAGCTGTTCCAGAATGAGGGAGG + Intergenic
950187986 3:10957235-10957257 CAGCAGATGCAGAAGCAGGAGGG + Intergenic
950284493 3:11733964-11733986 AAGCAGATGGAGAAAGAGCATGG + Intergenic
953041502 3:39258638-39258660 AAGTATATCCAGAATGACGGTGG + Intergenic
953121169 3:40044057-40044079 AAGCAGAAGCTGGATGAGGAAGG + Exonic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953892109 3:46759005-46759027 AAGCAAATACAGAATGAAAAAGG + Intronic
955458235 3:59149339-59149361 CAGGAGACCCAGAAGGAGGATGG - Intergenic
957335501 3:78822689-78822711 AAGTTGGACCAGAATGAGGAAGG - Intronic
957631940 3:82727354-82727376 AAACAGATCCAGAAAGATCAAGG + Intergenic
959993049 3:112649697-112649719 AGGCAGATCCAGAGTGAAGAGGG - Intergenic
961414730 3:126749039-126749061 AAGGAGACAAAGAATGAGGAGGG + Intronic
962264423 3:133935131-133935153 AAGCAGAGCCAGAAGGAGAGAGG + Intronic
962448472 3:135491164-135491186 ATGCAGATCCAATATGGGGAAGG - Intergenic
962702301 3:138011564-138011586 AAAGAGAACCAGACTGAGGAGGG + Intronic
963338440 3:144004095-144004117 AAGCAGATCAGGAATGGTGAAGG + Intronic
965395445 3:168155636-168155658 AATCAGATCCAGCATTTGGAAGG + Intergenic
965634248 3:170765165-170765187 AAGCAGATCCAGACCTAGAAAGG - Intronic
965830691 3:172784714-172784736 AAGCAAAACCAGAATGTGGACGG + Exonic
966158715 3:176945936-176945958 AAGATGAAACAGAATGAGGAAGG + Intergenic
966682780 3:182660981-182661003 AAGCATATTCAAAATGAGAAAGG - Intergenic
967442722 3:189527647-189527669 AGGCAGATGCATAATGAGGTGGG - Intergenic
967931434 3:194693260-194693282 GAGCAGCTCAAGAAAGAGGAAGG - Intergenic
968969565 4:3786556-3786578 AAGCAGAGAGAGAAAGAGGAGGG + Intergenic
969417773 4:7072222-7072244 AAGCAGACCAAGAATAAGGCAGG - Intergenic
971217055 4:24671555-24671577 AAGCAAATCCAGAAGTCGGATGG + Intergenic
972947898 4:44280523-44280545 AAGCTGCTCCAGAGTGAAGAAGG + Intronic
975854246 4:78606276-78606298 AAGGTGATCCAGGATGAAGAGGG + Intronic
976768781 4:88628098-88628120 AAGCAGATACAAAATTAGTAAGG - Intronic
978852298 4:113353749-113353771 AAGCAGAAACAAAAAGAGGAAGG + Exonic
979465853 4:121037606-121037628 CAGCAGATCATTAATGAGGAAGG - Exonic
981632599 4:146837731-146837753 AAACAGAGCCAGGATCAGGATGG + Intronic
982635822 4:157895478-157895500 AAGCAGAGCCAGAATCAGAGGGG + Intergenic
984821445 4:183886098-183886120 AGGCAGATGCAAAATCAGGAGGG + Intronic
985527233 5:412420-412442 AAGCAGCTCCAGAAAATGGAAGG + Intronic
986210140 5:5664476-5664498 AAGCAGATTCAGAACAAGAAAGG + Intergenic
986516235 5:8566853-8566875 GAGCAGATAAAGAATGACGAGGG - Intergenic
986641504 5:9876133-9876155 AAACAGCTCCAGAAGGATGAGGG + Intergenic
987097201 5:14560581-14560603 GAGCAGATTGTGAATGAGGAGGG - Intergenic
988004045 5:25384836-25384858 AAGGAGCTCTAGAATCAGGAAGG - Intergenic
989920780 5:49800077-49800099 AAACTGCTCCAGAATAAGGAAGG - Intergenic
990111319 5:52328733-52328755 AAGAAAATCCAGAGTGAGTAAGG + Intergenic
990123430 5:52484364-52484386 AAGAAGAAGGAGAATGAGGAGGG + Intergenic
991466316 5:66916042-66916064 AAACAGATCCAGAAAAAGAATGG + Intronic
992588363 5:78265575-78265597 AAGCTGATCCAGACTTAGAAAGG - Intronic
993668958 5:90736641-90736663 AAGCAGATCAATAATGAGTAAGG - Intronic
996646713 5:125826395-125826417 AAGTGGATCCAGAAGGAGAATGG - Intergenic
997251055 5:132388952-132388974 AAGCAGATCCAGAATGTTGTGGG - Exonic
997884277 5:137616279-137616301 AAGCAGCTTCAGCAGGAGGAGGG + Intergenic
998256037 5:140589334-140589356 AAGCAAGTCCAGAATCAGGAAGG + Intronic
998302614 5:141039683-141039705 ATGCCCCTCCAGAATGAGGAGGG + Intergenic
999801553 5:155042884-155042906 AAGCAGAGCCAGGAAGAGTAGGG - Intergenic
1000839020 5:166193129-166193151 ATGCAGATTAAGAATGGGGAAGG + Intergenic
1002045873 5:176541624-176541646 AAGCAGAGGCAGGAAGAGGAGGG + Intergenic
1002336949 5:178486235-178486257 AGGCAGCTGCAGAATGAGGACGG + Intronic
1002969088 6:1995823-1995845 AAGCAGGACCAGAAAGAGGGAGG - Intronic
1004288292 6:14343204-14343226 AAGCAGATTCAGAGGGAGCACGG + Intergenic
1007367714 6:41406635-41406657 AAGCAGAAGCAGAAGGAGGTTGG + Intergenic
1007821248 6:44561839-44561861 AAGCAGATCTATGAAGAGGAAGG - Intergenic
1007936531 6:45737469-45737491 GAGCAGAGCCAGTCTGAGGAGGG - Intergenic
1008384363 6:50871510-50871532 AAGCAAAACCAAAATGAAGATGG - Intergenic
1009622102 6:66090678-66090700 AATCTGCTCAAGAATGAGGAGGG - Intergenic
1009804597 6:68586716-68586738 AAACAGATCAATAATGAGAAAGG + Intergenic
1011133870 6:84078751-84078773 AAGCAGACCCATAAAAAGGAAGG - Intronic
1011534655 6:88363180-88363202 AAGCATATCAAGAAAGAGGAAGG - Intergenic
1011758553 6:90532083-90532105 AAGGAGGTGCAGAATGAAGATGG + Intronic
1013057951 6:106603462-106603484 AAGAACATGCAGTATGAGGATGG - Intronic
1013374010 6:109496598-109496620 AAGGAGAGCCAGGATGAGGAGGG - Intronic
1014233535 6:118930471-118930493 AAGCAGGTCCAGAATATTGAGGG - Intronic
1015981599 6:138845191-138845213 AAGCAGATGCACAATGGTGATGG - Intronic
1018204184 6:161421483-161421505 AAGCAGGACCAGCATGAGGGTGG + Intronic
1018788267 6:167125683-167125705 AAGCAGAACCAGAAGAAAGAGGG - Intronic
1020324012 7:6960650-6960672 AGCCAGATCCAGTGTGAGGAGGG + Intergenic
1020935694 7:14460981-14461003 AACCAGATCCTGAATGAGTACGG + Intronic
1021937000 7:25640796-25640818 AAGCAGCTGAAGAATGAGGAAGG - Intergenic
1023255399 7:38307806-38307828 AAGCTGCACCAGGATGAGGAAGG + Intergenic
1023795885 7:43791739-43791761 AAGCTGATCCAAACTGAGAAGGG - Intronic
1025855498 7:65273402-65273424 GAACAGATCAATAATGAGGAAGG - Intergenic
1026309103 7:69168297-69168319 ATTAAGAGCCAGAATGAGGACGG + Intergenic
1030556713 7:111034155-111034177 AAGTAGTTACAAAATGAGGAGGG + Intronic
1031483625 7:122304973-122304995 AAGCAGATTGAGAATTAGAAAGG - Intronic
1033225234 7:139556572-139556594 AAGTAAATCCAGGCTGAGGAAGG - Intergenic
1033609067 7:142948084-142948106 AAACAAATCAAGAATGAGAAGGG - Intronic
1034076019 7:148231864-148231886 ATGCAGTTCCAGAAAAAGGAAGG + Intronic
1035794719 8:2344256-2344278 AAGTAGATACAGACTGATGAGGG + Intergenic
1036744064 8:11391512-11391534 AAGGAGTTCCAGAAGGAGGACGG - Intronic
1037003194 8:13746615-13746637 CAGCAGATTCTGAATGAGGTAGG - Intergenic
1037064860 8:14565720-14565742 AAACATATCCAGAAAGAGGAGGG + Intronic
1037636140 8:20702388-20702410 AAGCAAAGCCAGAAAGAGAAGGG + Intergenic
1038398993 8:27268836-27268858 ATGCAGATGCAGAATAAGGTGGG - Intergenic
1039556936 8:38483267-38483289 AAGCAGAAACAGGAAGAGGAAGG - Intergenic
1041131489 8:54706902-54706924 AAGTAGATTCTGATTGAGGAAGG + Intergenic
1042605957 8:70546832-70546854 AAGCAGATCCAGAATGGAAGAGG - Intergenic
1043317082 8:78936450-78936472 GAACAGATCCATAATGAGTAAGG + Intergenic
1043414144 8:80030997-80031019 AAGAAAATCCAGAGTGAGGGTGG - Intronic
1044506045 8:93020733-93020755 AATCAGATGCTGACTGAGGAGGG + Intergenic
1044611366 8:94095494-94095516 AGGCAGAGCCAGCATGAGAATGG + Intergenic
1045784618 8:105905621-105905643 AAACAGAAGCAAAATGAGGAAGG + Intergenic
1046181779 8:110658667-110658689 AAGCAGATCAAAAATGACAAAGG + Intergenic
1046779622 8:118201233-118201255 ATGCAGAGCCAGAAGGAGGCTGG - Intronic
1047756972 8:127926440-127926462 AAGCAGCTCCAGTTGGAGGAAGG - Intergenic
1048683007 8:136867398-136867420 AAGAAGATCCAGGATGGTGAAGG - Intergenic
1048886207 8:138911984-138912006 AAGGAAATCTAGAATGAGGTGGG + Intronic
1051867196 9:21695959-21695981 AAGAAGATCCAGAATGACGCTGG + Intergenic
1053116521 9:35509051-35509073 AATCAGAATCAGAATGAGGCTGG + Intronic
1053422473 9:37988145-37988167 AAGCAGTTCCAAAGTGAAGAAGG - Intronic
1053504048 9:38625560-38625582 AAGAAGAGGCAGAAAGAGGATGG - Intergenic
1054947307 9:70809815-70809837 AAGCAGCTCTGGAATTAGGAAGG - Intronic
1055053379 9:72001290-72001312 AAGGGGATGCAGAAGGAGGATGG + Intergenic
1055367195 9:75557145-75557167 AAGAAGATAAAGAATGAGGAAGG + Intergenic
1055391550 9:75827255-75827277 AAGCAAAAGCAGAATGTGGATGG + Intergenic
1057521066 9:95760844-95760866 ATGCAGATCCAGAATCACCAGGG + Intergenic
1058593457 9:106589503-106589525 AAGAAGAAGAAGAATGAGGAGGG + Intergenic
1059664674 9:116435203-116435225 AACAAGGTCCAGAATGGGGATGG + Intronic
1060277598 9:122193741-122193763 AACCAGGTCCTGAAGGAGGAAGG + Intronic
1060431077 9:123551898-123551920 TACCAGATCCAGAAGGAAGAAGG - Intronic
1061443413 9:130622765-130622787 AAAAAGATCCAGAATGATGCTGG + Exonic
1185886773 X:3790169-3790191 AAGCAGTTCCAAGAGGAGGAAGG + Intergenic
1186072904 X:5842106-5842128 AAGCAGAAGCAGAAACAGGAGGG + Intronic
1186141692 X:6581352-6581374 AAACAGATTCACAATGAGCAAGG - Intergenic
1188291602 X:28395774-28395796 ATGCAGGTCCTTAATGAGGATGG + Intergenic
1188314824 X:28660065-28660087 AAGCAGAAGCAGAGTGAGGATGG + Intronic
1188349745 X:29113364-29113386 AAGAAGATCAATAAAGAGGAGGG - Intronic
1188602215 X:31981591-31981613 AAGAAGAACCAGAAAGACGAAGG + Intronic
1189867952 X:45351148-45351170 AAGCAGAGCCAGAAAGAAGAAGG - Intergenic
1190473046 X:50801571-50801593 AAGCAGATACAGTATGTGCAAGG + Intronic
1191815090 X:65235403-65235425 AAGCAAAACCACAATGAGGTAGG - Intergenic
1192005602 X:67208750-67208772 AATGAGGTCCAGAAAGAGGAAGG - Intergenic
1192502364 X:71662461-71662483 TAACAGCTCCAGAAAGAGGACGG + Intergenic
1194154670 X:90372184-90372206 AAGCAAATCCAGAATGAGTAAGG - Intergenic
1195430731 X:104786316-104786338 GAACAGATACAGATTGAGGAAGG - Intronic
1195486618 X:105415311-105415333 AAGCAAAACCAGCATTAGGATGG + Intronic
1195710069 X:107766508-107766530 AAGCAGATACAAAAGGAAGAGGG + Intronic
1195924438 X:110011723-110011745 GAGCAGGTCTAGGATGAGGATGG + Intronic
1197425311 X:126289755-126289777 AAGTAGTTCCTGAAGGAGGAAGG + Intergenic
1200501024 Y:3949076-3949098 AAGCAAATCCAGAATGAGTAAGG - Intergenic
1201348694 Y:13014839-13014861 GAGCAGACCAAAAATGAGGAAGG - Intergenic
1202074411 Y:21023966-21023988 AAGTACATACAGAATCAGGAAGG - Intergenic