ID: 902805819

View in Genome Browser
Species Human (GRCh38)
Location 1:18860690-18860712
Sequence CATTCCAGCCATGTGGTGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 221
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 194}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902805819_902805828 26 Left 902805819 1:18860690-18860712 CCACACACCACATGGCTGGAATG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 902805828 1:18860739-18860761 GCTGCGCTCCATGGTTCTGATGG 0: 1
1: 0
2: 2
3: 12
4: 120
902805819_902805825 17 Left 902805819 1:18860690-18860712 CCACACACCACATGGCTGGAATG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 902805825 1:18860730-18860752 TACCCGGCTGCTGCGCTCCATGG 0: 1
1: 0
2: 0
3: 9
4: 86
902805819_902805829 27 Left 902805819 1:18860690-18860712 CCACACACCACATGGCTGGAATG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 902805829 1:18860740-18860762 CTGCGCTCCATGGTTCTGATGGG 0: 1
1: 0
2: 1
3: 4
4: 74
902805819_902805824 1 Left 902805819 1:18860690-18860712 CCACACACCACATGGCTGGAATG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 902805824 1:18860714-18860736 GTCTGTCACAGGCACATACCCGG 0: 1
1: 0
2: 0
3: 15
4: 139
902805819_902805823 -10 Left 902805819 1:18860690-18860712 CCACACACCACATGGCTGGAATG 0: 1
1: 0
2: 2
3: 24
4: 194
Right 902805823 1:18860703-18860725 GGCTGGAATGGGTCTGTCACAGG 0: 1
1: 0
2: 2
3: 11
4: 158

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902805819 Original CRISPR CATTCCAGCCATGTGGTGTG TGG (reversed) Intronic
902805819 1:18860690-18860712 CATTCCAGCCATGTGGTGTGTGG - Intronic
903213508 1:21831179-21831201 CACGGCAGCCAGGTGGTGTGTGG + Intronic
903615891 1:24656202-24656224 CATTGCAGCCTTGGGGAGTGGGG - Intronic
905262082 1:36726844-36726866 CATTCCAGGCATGAGGAATGAGG - Intergenic
905998815 1:42405515-42405537 CACTCCAGGCATCTGGAGTGAGG + Intronic
908463630 1:64370069-64370091 CACTCCAGCCATCTGGTCTGGGG + Intergenic
910435549 1:87201996-87202018 CGTTCCAGCCAGGTGGCGGGTGG - Intergenic
917497645 1:175555854-175555876 CCTTCCAACCATGAGTTGTGTGG + Intronic
918578838 1:186100388-186100410 AATTCTATCCATGTGGTGGGAGG + Intronic
919858610 1:201722909-201722931 CAGTCCGGCCAACTGGTGTGGGG + Intronic
920735304 1:208527970-208527992 CTTACCAGGCATGTGGTATGGGG + Intergenic
922155232 1:223035911-223035933 CCATTCAGCCATGTGGTGGGAGG + Intergenic
1063502816 10:6570247-6570269 CGTTCAAGACATGTGGGGTGAGG + Intronic
1067555082 10:47263970-47263992 CACTCCAGCCTTGCGGAGTGTGG - Intergenic
1067810070 10:49419206-49419228 CATTCCTGCCAAGGGCTGTGGGG + Intergenic
1068551771 10:58415313-58415335 CAATCCACCCTTGTGCTGTGTGG + Intergenic
1068689116 10:59897974-59897996 CAATCCAGCCTTGTGGTGCCAGG - Intronic
1070832351 10:79425966-79425988 CAGTCCATCCTTGTGGGGTGAGG - Intronic
1070985262 10:80684110-80684132 CATTGCAGCCATGTGGGGAGGGG - Intergenic
1072923268 10:99594631-99594653 CAATCCAGCCTTATGGTGAGGGG + Intergenic
1073800249 10:107033862-107033884 CTTTCCAGCCATGTGGGGTGAGG + Intronic
1074284900 10:112088919-112088941 CATTCCAACCATGCTGTGAGAGG + Intergenic
1075968764 10:126635343-126635365 CATTCAAGGCATGGGGGGTGCGG + Intronic
1076581427 10:131514572-131514594 CTTTCAAGCCATGTGCTGTCTGG + Intergenic
1076786823 10:132754073-132754095 CATGCCAGCCATGCAGGGTGAGG + Intronic
1079344858 11:19643038-19643060 CATAGCTGCCATCTGGTGTGGGG + Intronic
1079545967 11:21632200-21632222 CATTCCAGCCAGATGGTAAGTGG + Intergenic
1080052495 11:27871363-27871385 CATTCCAGCCACCAGGTCTGAGG + Intergenic
1081064086 11:38518364-38518386 AATTCTTGCCATGTGGTGGGTGG + Intergenic
1081176870 11:39938168-39938190 CCTTCCTGCCATGTGCTATGAGG - Intergenic
1083446805 11:62713552-62713574 CATTCCAGCCTTGGGGTCAGAGG + Exonic
1087721104 11:101666057-101666079 CATTCCAGCGGTGGGGAGTGGGG + Intronic
1088831359 11:113539578-113539600 CAATCCAGGCAGGTAGTGTGGGG - Intergenic
1089574624 11:119432576-119432598 CACTCCAGGCATGAGGTGTGGGG + Intergenic
1090185442 11:124736584-124736606 CCTTCCTGACATGTGGGGTGAGG + Intergenic
1090881265 11:130833163-130833185 CATGACAGCCCTGTGATGTGGGG - Intergenic
1091101870 11:132881986-132882008 CATTCTAGCCCTGTGGTTAGGGG + Intronic
1091181496 11:133608361-133608383 AATTCTGCCCATGTGGTGTGAGG + Intergenic
1091749851 12:3015424-3015446 CATTTCACCCATGTGGCATGAGG - Intronic
1092889058 12:12952039-12952061 CACTCCAGCCATCTGGTCTGGGG - Intronic
1097156913 12:57018636-57018658 CATTCCTTCCTTCTGGTGTGGGG - Intronic
1099955455 12:89349225-89349247 CATTCCAGCAAGGAGGGGTGTGG + Exonic
1104654246 12:130561243-130561265 CGTTTCAGCCATGTGGTCTGTGG + Intronic
1105212868 13:18267497-18267519 CATTGCAGCCCTGTTGTGTGTGG - Intergenic
1106661312 13:31802610-31802632 CTTTTCAGGCATGTGGGGTGAGG - Exonic
1108091817 13:46857323-46857345 CATTCCAGCCTTGAGATCTGTGG - Intronic
1108457287 13:50629169-50629191 CATTCCAGCCTGCTGGTATGTGG - Intronic
1111113780 13:83749841-83749863 CATGCCAGCAAAGTGATGTGGGG - Intergenic
1111629297 13:90828370-90828392 GATTTCAGCCATCTTGTGTGTGG - Intergenic
1111736181 13:92141998-92142020 CATTCCAAGCATGAGATGTGAGG - Intronic
1112563402 13:100533005-100533027 TAGTCCATCCAGGTGGTGTGGGG - Intronic
1113263918 13:108595354-108595376 CCTTCCAGCCATGTGGGGTGGGG - Intergenic
1113888536 13:113724610-113724632 CAACCCAGCCATGAGGGGTGTGG - Intronic
1120473086 14:84951477-84951499 AATTCCACCCATGTAGTGTGAGG + Intergenic
1121096499 14:91221185-91221207 CATAGCAGCCATGTGGTTTGGGG + Intronic
1121988113 14:98528183-98528205 GCTGCCAGCCATGTGGAGTGAGG + Intergenic
1122020999 14:98837796-98837818 CATGCCAGCTGTGTGATGTGAGG + Intergenic
1202890675 14_KI270722v1_random:154337-154359 CATTTCAGCCATTGGATGTGGGG - Intergenic
1124797549 15:32796914-32796936 CATTCCAGCCATGCTCTGTGAGG - Intronic
1125615678 15:41010148-41010170 CATGCCACTGATGTGGTGTGTGG - Intronic
1128931553 15:71709079-71709101 CATACTAACCATGTGGTTTGGGG + Intronic
1129451319 15:75652764-75652786 CCTCCCAGGCCTGTGGTGTGGGG + Intronic
1130726206 15:86442141-86442163 GGTACCAGCTATGTGGTGTGTGG + Intronic
1130881381 15:88058717-88058739 TCTTCCAGCCATGTGGCTTGTGG - Intronic
1131718207 15:95136896-95136918 CAATCCAGCGTTGTGGTTTGAGG - Intergenic
1133438940 16:5804564-5804586 CATTCCACCCAGATGGTGGGAGG + Intergenic
1138065187 16:53933497-53933519 CATGCCAGCAATGTTTTGTGGGG - Intronic
1142768892 17:2082497-2082519 GACTCCAGCCTGGTGGTGTGAGG + Intronic
1142817261 17:2436170-2436192 GATTTTAACCATGTGGTGTGAGG + Intronic
1143681843 17:8481577-8481599 CAGGCCAGCCAGGTGGTGTGTGG + Intronic
1144369660 17:14577944-14577966 GATCCCATCCATGTGGTGTCAGG + Intergenic
1144968515 17:19092741-19092763 CTCACCAGCCATGTGGTCTGTGG + Intergenic
1144979402 17:19159322-19159344 CTCACCAGCCATGTGGTCTGTGG - Intergenic
1144988820 17:19218910-19218932 CTCACCAGCCATGTGGTCTGTGG + Intronic
1149278985 17:55081083-55081105 CATTCCTTCCCAGTGGTGTGAGG - Exonic
1149738229 17:59016886-59016908 CTTTCCAGCCAGGTGTGGTGGGG + Intronic
1151627556 17:75286728-75286750 TATTCCTGCCATCTGGTTTGGGG + Exonic
1151806104 17:76406400-76406422 CTCTCCAGCCATGTGGTTTGGGG - Intronic
1152076353 17:78162298-78162320 CTTGCCAGCCATGTGGCCTGGGG - Intronic
1152681905 17:81672786-81672808 CATGCCAGCAGTGTGGGGTGAGG + Exonic
1152862313 17:82703493-82703515 CCTTCCAGCCCTGTGGTCTCTGG + Intergenic
1156507824 18:37609672-37609694 CATGCCAGAAATGTGGTGAGAGG - Intergenic
1156570147 18:38243571-38243593 CATTTCAGCCATTTGGGGTTTGG + Intergenic
1159184745 18:64955029-64955051 CATTCCAGATGTGAGGTGTGAGG + Intergenic
1161216091 19:3095612-3095634 CATTCCAGCCAAGAGGAGTACGG - Intronic
1161478367 19:4498576-4498598 CTTTCCCGGCAGGTGGTGTGTGG + Intronic
1163004912 19:14391105-14391127 CTTTCCATCCATGAGGTTTGGGG + Intronic
1163177891 19:15577284-15577306 CATTCCAGGGATGTGGTGAGTGG + Intergenic
1165728769 19:38130786-38130808 CCTTTCAGCCAGGTGGTGGGTGG + Intronic
1165771153 19:38381075-38381097 CATTCCAGCCATTGGTTGTCTGG + Intronic
1202666097 1_KI270708v1_random:121175-121197 CATTTCAGCCATTGGATGTGGGG - Intergenic
925374750 2:3376229-3376251 CATAACAGCCATGAGGTGGGGGG + Intronic
925687913 2:6492245-6492267 CATTGCAGCCAGATGGTGAGAGG + Intergenic
926392368 2:12406349-12406371 TGCTCCAGCCATGTGATGTGTGG - Intergenic
927112210 2:19871662-19871684 ATTTACAGCCATGTGGTGTAGGG + Intergenic
928610675 2:32989041-32989063 CATTCCAGAAAGGTGGTGTTTGG + Intronic
930060849 2:47287180-47287202 CCTTCCAGCCCTGTGCTCTGTGG + Intergenic
930203145 2:48563349-48563371 CATTCCAGTCATGGTCTGTGTGG + Intronic
930716417 2:54597654-54597676 CATTCCCTCCCTGTGGTGGGTGG + Intronic
931501573 2:62874881-62874903 CATGCCATCAAAGTGGTGTGGGG - Intronic
932474089 2:71990364-71990386 CTTTCCAGCCAGGTGGCCTGTGG - Intergenic
933760933 2:85671528-85671550 CTTTCCAGGGATGTGGTGCGTGG - Intergenic
934941509 2:98506417-98506439 CAGCCCAGCGGTGTGGTGTGAGG + Intronic
936089080 2:109489354-109489376 CAATCCAGGCATGTGGCCTGGGG + Intronic
937352106 2:121172515-121172537 CTTCCCAGCCATGTGTTTTGTGG + Intergenic
937536234 2:122891410-122891432 CAGTGCATGCATGTGGTGTGGGG - Intergenic
937569174 2:123334748-123334770 CATGCCAGCAAAGTGATGTGGGG - Intergenic
939372281 2:141316767-141316789 CTTTCCCGCCATGGGGGGTGAGG + Intronic
941298497 2:163771434-163771456 GACTCCAGACATGGGGTGTGTGG - Intergenic
942544438 2:177048171-177048193 CATTCCAGCCATGGGAAGGGAGG - Intergenic
942751704 2:179295144-179295166 TATTCCAGCCTTGTAGGGTGGGG + Intergenic
945800547 2:214423934-214423956 CATTCCTGCCATCTAGTGAGAGG - Intronic
947541455 2:230982633-230982655 CATCCCAGCACTGTGGTGGGAGG + Intergenic
948616944 2:239205082-239205104 CCTGCCAGCCACGTGGGGTGGGG - Intronic
948698804 2:239747887-239747909 GGTTCTAGCCATGTGGGGTGTGG - Intergenic
1168902012 20:1372843-1372865 CATACCAGACATTTGCTGTGAGG + Intronic
1172114603 20:32566231-32566253 CTTTCCAGCCATGTGATCTTAGG - Intronic
1172331562 20:34079305-34079327 GATTTCAGCCCAGTGGTGTGTGG + Intronic
1172829234 20:37818493-37818515 TATTCCAGCCTTGTGGTCTTGGG + Intronic
1174401997 20:50280935-50280957 CATTCCAGCCATGTGGCCTTGGG + Intergenic
1175894567 20:62330433-62330455 CATTCCAGCCTCATCGTGTGTGG + Intronic
1175991145 20:62789922-62789944 CCTGCCTGCCATGGGGTGTGTGG - Intergenic
1179336488 21:40461528-40461550 CATTCCAGCTCTGGGGTCTGGGG + Intronic
1180815685 22:18787818-18787840 CATTGCAGCCCTGTTGTGTGTGG - Intergenic
1181201873 22:21222153-21222175 CATTGCAGCCCTGTTGTGTGTGG - Exonic
1181699877 22:24614815-24614837 CATTGCAGCCCTGTTGTGTGTGG + Exonic
1185137367 22:49080418-49080440 CATTTCAGCCGTGTGCTCTGCGG + Intergenic
1203225038 22_KI270731v1_random:73275-73297 CATTGCAGCCCTGTTGTGTGTGG + Intergenic
1203265790 22_KI270734v1_random:13509-13531 CATTGCAGCCCTGTTGTGTGTGG - Intergenic
950011208 3:9725159-9725181 CATCCCAGCCCTCTGGAGTGAGG - Intronic
950448326 3:13051228-13051250 CATTCCAGCCATGCTGAGTGAGG + Intronic
953668330 3:44942045-44942067 CCTTCCAGCCCTATGGTGTGTGG - Intronic
955082352 3:55669747-55669769 CATCCCAGCCAGGTGGTTTTTGG + Intronic
955536612 3:59930274-59930296 CATTGCAGCCATGGTGGGTGGGG + Intronic
957089796 3:75718286-75718308 CATCCCAGCCATTGGATGTGGGG + Intronic
959310941 3:104736061-104736083 AATTCCAGCCCTGGTGTGTGTGG - Intergenic
965720610 3:171657013-171657035 CACTAGAGTCATGTGGTGTGAGG + Intronic
966119989 3:176510611-176510633 TAGTCCTGCCATGTTGTGTGGGG + Intergenic
966443950 3:179979548-179979570 CATTCCAGTCCTGTTGTGTCGGG - Intronic
968496387 4:919556-919578 CCTTCCAGGCCTGTGGTGTGTGG - Intronic
977073123 4:92418228-92418250 CATTCCAGCCATAGAGTGTGGGG - Intronic
977170804 4:93759992-93760014 CTTTCCAGCCATGTGGCCTTGGG + Intronic
979720292 4:123891893-123891915 CATCCCAGTCATGTGCTGTAAGG + Intergenic
980724086 4:136735588-136735610 TTTCCTAGCCATGTGGTGTGTGG - Intergenic
982630235 4:157822089-157822111 CCTGCCGGCCATGTGGAGTGTGG - Intergenic
984853169 4:184171178-184171200 CCTTCCAGCCCTCTGGTGTCAGG - Intronic
986450433 5:7858064-7858086 CAACCCAGCAATGTGGTGTGAGG - Intronic
986797649 5:11227965-11227987 CATCCCAGCCTTGTGGAGTCAGG - Intronic
987104001 5:14618949-14618971 CATTCCAGGGATGAGGAGTGGGG - Intergenic
990056701 5:51590431-51590453 CTGTCTGGCCATGTGGTGTGAGG + Intergenic
990979741 5:61591964-61591986 CATGCCTGGCATGTGCTGTGGGG + Intergenic
993493930 5:88586577-88586599 TATTCCAGCCCTGTGCTCTGTGG + Intergenic
995452435 5:112316857-112316879 CATTCCAGCCATCTCAGGTGAGG - Intronic
995755315 5:115497320-115497342 CAAAACAGTCATGTGGTGTGGGG - Intergenic
995992273 5:118255148-118255170 CTTGCCATCCATGTGGTATGTGG - Intergenic
998071619 5:139202212-139202234 CATGCCAGCCATTGGCTGTGGGG + Intronic
998602117 5:143595295-143595317 GATTCCAGGCATGTGGGGTTTGG + Intergenic
999045949 5:148469662-148469684 GATTCCAGCCATTTGGTCTCAGG - Intronic
1000339795 5:160268333-160268355 CTTACTAGCCATGTGGTCTGGGG + Intronic
1000636982 5:163655755-163655777 CATTCCAGGCATGCGTAGTGAGG - Intergenic
1002849515 6:981342-981364 CATTCCAGCGCTGAGGAGTGGGG - Intergenic
1004026794 6:11827145-11827167 TACTCCAGGCATGTGGGGTGCGG + Intergenic
1005668521 6:28081285-28081307 CATTCCAGCCAGGTGGAACGGGG + Exonic
1007078463 6:39082732-39082754 CATTCCAGCCCAGTGGTGATGGG + Intronic
1007746048 6:44043590-44043612 CTTTCCAGCTGTGTGATGTGGGG - Intergenic
1008337826 6:50327686-50327708 AATTCCAGCCAATTAGTGTGTGG - Intergenic
1009625688 6:66137045-66137067 CAAGCCAGCCCTGTGGTGGGAGG - Intergenic
1009849626 6:69179687-69179709 CATTCCTTCCCTGGGGTGTGTGG + Intronic
1012226969 6:96715929-96715951 CATTACACCCAGGTGTTGTGAGG + Intergenic
1014832802 6:126122564-126122586 CATTCCTTCCTTCTGGTGTGGGG - Intergenic
1015083986 6:129265177-129265199 CATTCCAAACAAGTGATGTGGGG - Intronic
1016493573 6:144634133-144634155 CAGTCCAGGCATGGGATGTGTGG + Intronic
1017696199 6:157018880-157018902 CATTCCAACCATGGGGGGTCAGG + Intronic
1018389180 6:163329760-163329782 CTTTCCTTCCAGGTGGTGTGAGG + Intergenic
1018810750 6:167296193-167296215 TATTCCAGTCATCCGGTGTGTGG + Exonic
1018900862 6:168051080-168051102 CATCACAGCCATGTGGACTGTGG + Intergenic
1019422398 7:957136-957158 TATTCCAGTCCTGAGGTGTGTGG - Intronic
1022317101 7:29255461-29255483 CCTTCCAGCCATGAGGTCAGAGG + Intronic
1023360979 7:39414714-39414736 CATTTCAGAAATGTGGTGGGGGG - Intronic
1023910989 7:44556349-44556371 GGATCCTGCCATGTGGTGTGTGG + Intergenic
1024049462 7:45609627-45609649 TGTTCCAGAAATGTGGTGTGAGG - Intronic
1024585636 7:50839548-50839570 CATTCCAGCACCATGGTGTGGGG + Intergenic
1026454384 7:70557997-70558019 CTTCCCAGCCAGGTGGAGTGGGG + Intronic
1026989199 7:74573718-74573740 CCTTCCAGCCTTGTGGGGAGGGG + Intronic
1031960492 7:127985137-127985159 CATTCCCAGCTTGTGGTGTGCGG + Intronic
1032351131 7:131165069-131165091 CATTCCAGCCAGGGAGAGTGGGG + Intronic
1034125159 7:148664695-148664717 CATTCCATCCCTGTGTTGTTGGG + Intergenic
1039264429 8:35809074-35809096 CATGCCAGCAAAGTGATGTGGGG - Intergenic
1041762678 8:61384017-61384039 CAATCTAGCCATGTGGAGTTAGG + Intronic
1045479583 8:102581428-102581450 CCTTCCAGCCCAGTGGGGTGTGG - Intergenic
1046001570 8:108426665-108426687 CATCTAAGCCATCTGGTGTGTGG - Intronic
1047650020 8:126910551-126910573 CACTCCAGCCTTCTGGTCTGAGG + Intergenic
1047672630 8:127164998-127165020 CTTTCCAGCCGTGTGGTCTTGGG - Intergenic
1048651087 8:136478443-136478465 CAGTACTGCCATGTAGTGTGTGG + Intergenic
1048844591 8:138594608-138594630 CATTCCAGCCCAGTGGGGTAGGG - Intronic
1050168435 9:2790845-2790867 CATATCAGCCATTTGGAGTGGGG - Intronic
1056118263 9:83462241-83462263 CCTTCCAGCCCGGTGGTATGGGG - Intronic
1056800257 9:89686005-89686027 ATTCCCACCCATGTGGTGTGGGG + Intergenic
1059351280 9:113666935-113666957 CTTTCCAGCTGTGTGGTGTTAGG + Intergenic
1059983121 9:119795018-119795040 AAATCCTGCCATATGGTGTGTGG + Intergenic
1061915824 9:133753216-133753238 TGTTCCAGCCATGGAGTGTGTGG - Intergenic
1062332166 9:136049594-136049616 CTTCCCAGCCAGGTGGTGTGGGG + Intronic
1203487771 Un_GL000224v1:73440-73462 CATGCCAGCCATTGGATGTGGGG - Intergenic
1203500392 Un_KI270741v1:15335-15357 CATGCCAGCCATTGGATGTGGGG - Intergenic
1187865319 X:23718337-23718359 TATTCCAGAGAAGTGGTGTGGGG - Intronic
1189436535 X:40997870-40997892 CAATCCAGTCATGGGGTGGGTGG + Intergenic
1191654910 X:63586017-63586039 CACACCAGCAAAGTGGTGTGGGG + Intergenic
1192690139 X:73353988-73354010 CATTCCAGCAAAGTGGTTGGTGG + Intergenic
1193833968 X:86320567-86320589 CAGTCCTGCCATATTGTGTGGGG + Intronic
1194781331 X:98028630-98028652 CACACCAGCAATGTGATGTGGGG + Intergenic
1197290111 X:124645316-124645338 GATTCCTGCCCTGTGCTGTGTGG - Exonic
1197445900 X:126552268-126552290 AACTCCAGGCAGGTGGTGTGCGG - Exonic
1197774052 X:130108891-130108913 TATCCCAGCCAGCTGGTGTGAGG - Intronic
1198139800 X:133791305-133791327 CATTGCAGACCTGTGGTGTCTGG - Intronic
1198935509 X:141899468-141899490 CATTCTAGCTATGTGGTCTTGGG - Intergenic
1199640748 X:149858652-149858674 TATGCCAGCAAAGTGGTGTGGGG - Intergenic
1199947651 X:152681160-152681182 CATTTCTGCCATGTGGTTGGAGG + Intergenic
1199962028 X:152787294-152787316 CATTTCTGCCATGTGGTTGGAGG - Intergenic
1200252576 X:154561574-154561596 CATTCCAGGCCTGTGATGCGAGG + Intronic
1200265191 X:154642842-154642864 CATTCCAGGCCTGTGATGCGAGG - Intergenic
1201552440 Y:15232385-15232407 CACTCCAGCACTGTGGTTTGGGG - Intergenic