ID: 902806245

View in Genome Browser
Species Human (GRCh38)
Location 1:18863084-18863106
Sequence GGGCCATCCCAGAACCCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 267
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 240}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902806245_902806253 14 Left 902806245 1:18863084-18863106 CCATGGGGGTTCTGGGATGGCCC 0: 1
1: 0
2: 2
3: 24
4: 240
Right 902806253 1:18863121-18863143 TCAGGTCCCACCCCAGCTGTTGG 0: 1
1: 0
2: 1
3: 24
4: 196
902806245_902806254 15 Left 902806245 1:18863084-18863106 CCATGGGGGTTCTGGGATGGCCC 0: 1
1: 0
2: 2
3: 24
4: 240
Right 902806254 1:18863122-18863144 CAGGTCCCACCCCAGCTGTTGGG 0: 1
1: 0
2: 2
3: 21
4: 184
902806245_902806255 16 Left 902806245 1:18863084-18863106 CCATGGGGGTTCTGGGATGGCCC 0: 1
1: 0
2: 2
3: 24
4: 240
Right 902806255 1:18863123-18863145 AGGTCCCACCCCAGCTGTTGGGG 0: 1
1: 1
2: 0
3: 23
4: 147
902806245_902806246 -4 Left 902806245 1:18863084-18863106 CCATGGGGGTTCTGGGATGGCCC 0: 1
1: 0
2: 2
3: 24
4: 240
Right 902806246 1:18863103-18863125 GCCCTGCCCTCCCTCAACTCAGG 0: 1
1: 0
2: 5
3: 52
4: 423
902806245_902806257 20 Left 902806245 1:18863084-18863106 CCATGGGGGTTCTGGGATGGCCC 0: 1
1: 0
2: 2
3: 24
4: 240
Right 902806257 1:18863127-18863149 CCCACCCCAGCTGTTGGGGAAGG 0: 1
1: 0
2: 4
3: 28
4: 295

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902806245 Original CRISPR GGGCCATCCCAGAACCCCCA TGG (reversed) Intronic
900543427 1:3215583-3215605 GGACCAACCCAGAACCCCACAGG + Intronic
900634018 1:3652915-3652937 GGGCCCTCCCGGAACCCCTGCGG - Intronic
900684429 1:3939050-3939072 GGGCCATTCCAGGACACCGAGGG + Intergenic
901265899 1:7910426-7910448 GGCCCTACACAGAACCCCCAGGG + Intergenic
901527807 1:9835279-9835301 TGGGCATCCCACAACCCCCAGGG + Intergenic
901876852 1:12171799-12171821 GGGCAATCCCCCAACCCCAAAGG - Intronic
902547509 1:17199206-17199228 TGGCCAAGTCAGAACCCCCAAGG + Intergenic
902724464 1:18325669-18325691 TGTACATCCCAGAACCCCCCTGG + Intronic
902806245 1:18863084-18863106 GGGCCATCCCAGAACCCCCATGG - Intronic
903568227 1:24285008-24285030 GGCCCAGCCCAGGAGCCCCATGG + Intergenic
903920254 1:26794914-26794936 GGAACATCCCAGAAGCACCAAGG - Exonic
905119709 1:35672347-35672369 AGGCCATCACAGAAGCCCCCTGG - Intergenic
907285315 1:53376188-53376210 GGGCCACTCCAGGACTCCCAGGG + Intergenic
908774634 1:67628144-67628166 GGGGCATCAGAGAAGCCCCAAGG - Intergenic
913319820 1:117580340-117580362 GGGCCATCTCTGCATCCCCAGGG - Intergenic
917006797 1:170424501-170424523 GGGACATCAGAGAAGCCCCAAGG - Intergenic
918097559 1:181347551-181347573 GGGCGATCCCAGAGCCTGCAGGG - Intergenic
919845230 1:201638178-201638200 AAGACAACCCAGAACCCCCAAGG + Intronic
920243841 1:204573318-204573340 GGGCCATCCCAGCATCCACCTGG - Intergenic
922730004 1:227944902-227944924 GAGCCAGCCCAGGACCCCTAAGG + Intronic
923144200 1:231186488-231186510 GGTCCTTCCCAGAGCCCTCAGGG - Intronic
1063668541 10:8081239-8081261 GGGCCATCCCAGAAAGACAAGGG + Intergenic
1067419739 10:46135035-46135057 TGGGACTCCCAGAACCCCCATGG - Intergenic
1067426279 10:46214376-46214398 TGGGACTCCCAGAACCCCCATGG + Intergenic
1067441477 10:46311246-46311268 GGACCATTGCATAACCCCCAGGG + Intronic
1067505090 10:46841632-46841654 TGGGACTCCCAGAACCCCCATGG - Intergenic
1069560557 10:69426461-69426483 GGGCCTTCCCAGAGCCAGCAAGG - Intergenic
1069770000 10:70892390-70892412 GGGCCATCCCAGATTCAACATGG - Intergenic
1071501804 10:86209747-86209769 GTCCCATCCCAGGACTCCCACGG + Intronic
1075092981 10:119453803-119453825 GGGCCATCCCAGGAGCCGGAAGG - Intronic
1075673747 10:124281818-124281840 CAGCCATCCCAGTGCCCCCACGG + Intergenic
1075727681 10:124618869-124618891 GGGCCATCCCAGGCCCCTCAGGG + Intronic
1075864464 10:125705837-125705859 CCTCCACCCCAGAACCCCCATGG + Intergenic
1076058160 10:127392313-127392335 GGACCATCCCTGAGTCCCCAGGG + Intronic
1077311474 11:1890759-1890781 GGGCCACCCCAAAGTCCCCAAGG - Exonic
1077889957 11:6411593-6411615 GTGCCATCCCAGAAAGCTCAGGG - Intronic
1079027469 11:16960532-16960554 GGGCCTTCCTAGAACCCCTAGGG - Intronic
1080532186 11:33187966-33187988 GTGCCATCCCAGAACCCCATGGG + Intergenic
1081674796 11:44962518-44962540 GGGCCATCCCTGATCTCCCCAGG + Intergenic
1081723247 11:45305298-45305320 GGGTCTTCCCAGAACCACCTTGG - Intergenic
1083031168 11:59593840-59593862 GGTGAATCCCAGAACCTCCAGGG + Intronic
1083332832 11:61906956-61906978 GGGCGGTCCCAGAACTCTCATGG - Intronic
1083617228 11:64032320-64032342 AGGCCATCTCAGACCTCCCAGGG - Intronic
1083650927 11:64204307-64204329 GGGCCCTCCCAGCACACGCATGG + Exonic
1083753046 11:64772864-64772886 GGCCCCTCCCAACACCCCCAAGG + Intronic
1084420380 11:69057756-69057778 GCTCCATCCCAGCACCCCCGTGG - Intronic
1085384346 11:76148572-76148594 GGGCCTTCACAGAGCTCCCAGGG - Intergenic
1085452174 11:76641010-76641032 GGGACAGCCCAGAACCCAAACGG - Intergenic
1085690426 11:78659713-78659735 GGGGCACCCCAGGAGCCCCAAGG - Intronic
1086955212 11:92928553-92928575 GGGCCAGCCCAGGCACCCCAGGG + Intergenic
1088526359 11:110760316-110760338 GGGCCATCCTCGCATCCCCAGGG - Intergenic
1089466618 11:118690002-118690024 GAGCCCTCCCCGTACCCCCAGGG - Intergenic
1094834195 12:34314590-34314612 GTGCCTTCCCAGCACCCCCTGGG - Intergenic
1095082040 12:38013625-38013647 GGGACATTCCAGAGCCCACAAGG + Intergenic
1096214635 12:49792445-49792467 GGGGCTGCCCAGGACCCCCATGG - Exonic
1101816950 12:108152611-108152633 GGGCCATCCCAGAAGCCCGAGGG + Intronic
1102607291 12:114077751-114077773 GGGCCATTCCAGAGCCCCACAGG + Intergenic
1111843037 13:93473501-93473523 GGGCCTTCCCAGACCCCTGAGGG + Intronic
1111932266 13:94524439-94524461 GGGCCAGCCCAGACCCTCCCTGG + Intergenic
1114665544 14:24375409-24375431 GGGCCAGCCCAGAAACCAGAGGG - Intronic
1115154631 14:30323872-30323894 ACACCATCCCAGAAACCCCAGGG - Intergenic
1116995460 14:51319164-51319186 GGGCCATCCCAGAACAGAAAGGG - Intergenic
1118972922 14:70652697-70652719 GATCCAGCCCAGAATCCCCAGGG - Intronic
1118995852 14:70835352-70835374 GGGCTATCACATAACCTCCATGG + Intergenic
1120034574 14:79681640-79681662 CGGCCCACCCAGAACCCCAAGGG + Intronic
1121844350 14:97159925-97159947 GGGCCATGCCAGAGTCCCCCTGG - Intergenic
1122070657 14:99203586-99203608 GGACCTTCCCAGGACCCCCATGG - Intronic
1122150328 14:99722078-99722100 AGCCCACCCCAGGACCCCCAGGG - Intronic
1122903711 14:104792472-104792494 AGGCCAGCCCAGGAGCCCCAGGG + Intronic
1122984324 14:105205337-105205359 GGGCCATGGGAGAACCTCCAGGG + Intergenic
1124210952 15:27764609-27764631 CGGCCACCCCAGAGCCACCAAGG + Intronic
1124436175 15:29651565-29651587 GGGCCTTCCCAGGCCCCCAAGGG - Intergenic
1125433807 15:39625179-39625201 GAGCCATCACAGAATGCCCAGGG - Intronic
1125849774 15:42891776-42891798 GGGCCTTCCCACAATCCCCTTGG - Intronic
1127556245 15:60090185-60090207 GAGCCTTCCCAGAACCCCCCAGG - Intergenic
1129269571 15:74412212-74412234 AGGCCATCCCAGGAGGCCCAGGG + Intronic
1129833096 15:78683178-78683200 GGGGCTGCCCAGAACCCCCACGG - Intronic
1132632986 16:928760-928782 GGCCCATCCCTACACCCCCATGG + Intronic
1132652375 16:1027380-1027402 TGGGCCTCCCAGAACCTCCATGG - Intergenic
1132663904 16:1073111-1073133 GGGTCAGCCCAGAAGCCACAGGG + Intergenic
1132664346 16:1074713-1074735 GGGTCAGCCCAGAAGCCACAGGG - Intergenic
1132835972 16:1953774-1953796 GGGCCATGACAGAACCCGCCCGG + Intronic
1132939247 16:2498827-2498849 GGCCCAACCCAGAGCTCCCACGG - Intronic
1133282921 16:4677348-4677370 GGGTCACCCCAGGACCCCTATGG + Intronic
1133490434 16:6262848-6262870 AGGCCATCTCACAACCCTCATGG + Intronic
1134021441 16:10923984-10924006 GGGCCAACCCTGAACCAGCAGGG - Exonic
1135490141 16:22901997-22902019 AGCCCAGCCCAGATCCCCCAAGG + Intronic
1135762019 16:25145387-25145409 GGGCCTTCCCAGAAGCCCTGGGG + Intronic
1138293754 16:55869570-55869592 TGGACATCCCAGATCCCCAAAGG - Intronic
1140992959 16:80232055-80232077 GGGCCATTCCCCAACACCCAAGG + Intergenic
1142930964 17:3283881-3283903 AGGTCATCCCAGAATCCCCCTGG - Intergenic
1142944451 17:3412628-3412650 AGGTCATCCCAGAATCCCCCTGG + Intergenic
1144105239 17:11978397-11978419 GGGGCAGCCAAGAGCCCCCATGG - Exonic
1145031467 17:19507813-19507835 GCTCCCTCCCAGAATCCCCATGG + Intronic
1147212630 17:38880718-38880740 GGTTCATCCCAGAATCCCCACGG - Intronic
1147673266 17:42189111-42189133 GAGCCATCCCAGGAAGCCCAAGG + Exonic
1147851979 17:43450747-43450769 GGGCCATCCCAAAATCCTTAAGG + Intergenic
1150510469 17:65747267-65747289 GGGCCAACCCAGAATGCACAAGG - Intronic
1150804947 17:68311359-68311381 GGACCATCACAGAACACCCGAGG - Intronic
1151712998 17:75817424-75817446 GGGCCAGGCCAGACTCCCCAGGG - Exonic
1152027695 17:77822452-77822474 GGGGGATCCCAGAGACCCCAAGG + Intergenic
1152358585 17:79819065-79819087 GGACCATCCCAGGGTCCCCAGGG - Intergenic
1152776292 17:82204083-82204105 GCGCCGTCTCAGGACCCCCAGGG - Intronic
1160487474 18:79307453-79307475 GGCACATCCCAGAACACCCAGGG + Intronic
1160605486 18:80046583-80046605 GTGCCAGCCCAGCAGCCCCAGGG - Intronic
1160861347 19:1238294-1238316 GTGCCGCCCCAGAACCCCCACGG - Intergenic
1160868206 19:1265489-1265511 AGGCCATCCCAGCAGCCCAAAGG - Intronic
1161106162 19:2445131-2445153 GGGCCCTCCCAGACCCCACTGGG + Intronic
1161237328 19:3204476-3204498 GGGGCCTCCCAGAACCCCCGAGG - Intronic
1161417015 19:4153038-4153060 GGGCTATCCCAGAACCCATCTGG + Intergenic
1161496133 19:4586885-4586907 GGGCCAACCCAGGACACACATGG - Intergenic
1161594029 19:5142207-5142229 GGGCCCTTCCAGGCCCCCCACGG + Intronic
1161773021 19:6241590-6241612 CGGCCACCCCAGGACCTCCAAGG - Intronic
1161857342 19:6773341-6773363 GGAGCTCCCCAGAACCCCCAGGG + Intronic
1164513620 19:28916368-28916390 GGGCCAAGCCAGCACCCCCTGGG + Intergenic
1164590889 19:29506208-29506230 GCACCATCCCAGGACCCCCGGGG + Intergenic
1164881097 19:31733654-31733676 TGGGCATCCCTGAAGCCCCAGGG + Intergenic
1165256367 19:34579197-34579219 AGGCCTTCCCTGCACCCCCATGG + Intergenic
1165669300 19:37662063-37662085 TTTCCATCCCAGAAGCCCCATGG + Intronic
1165802557 19:38561923-38561945 AGGGCACCCCAGAGCCCCCAAGG - Intronic
1165866918 19:38945260-38945282 GTTCCACCCCAGAACCACCAAGG - Intronic
1165952270 19:39481030-39481052 GAGGCGTCCCGGAACCCCCAAGG - Intronic
1167684589 19:50948858-50948880 GGGACAACCAAGAGCCCCCAAGG - Exonic
1168252020 19:55146837-55146859 GCGCCATCCCTGCACCGCCAGGG - Intronic
1168573706 19:57490962-57490984 GTGCCATCCCAGACCCCCAATGG - Intronic
925294016 2:2766008-2766030 GGGCCAGCTCACAACACCCACGG - Intergenic
927110257 2:19859378-19859400 GGGCATTTCCAGAATCCCCAAGG + Intergenic
927702053 2:25275199-25275221 GGGCCTGCCCAGCACTCCCAGGG - Intronic
929510940 2:42565590-42565612 AGGCCATGCCAGAAATCCCAGGG - Intronic
929541172 2:42823425-42823447 TGGCCATTGCAGAAGCCCCAAGG - Intergenic
932213752 2:69952955-69952977 AGGGCAGCACAGAACCCCCAGGG + Intergenic
932706824 2:74032403-74032425 GGGCCATCGCCCAAGCCCCATGG - Intronic
932814492 2:74851072-74851094 GGGTCATCCAAGAAACCACAGGG + Intronic
932917856 2:75876673-75876695 GGGCTATCCCTGAACCCCTGGGG - Intergenic
933754056 2:85623824-85623846 GAGCCATCCCAGGGCTCCCAGGG + Intronic
937218945 2:120330423-120330445 AGGCCATCCCACAGCCACCATGG + Intergenic
937248671 2:120510176-120510198 GGGCCAGCCCACAGCCCCCATGG - Intergenic
937277533 2:120694957-120694979 TGGCCACCCCAGAACGCCCCAGG + Intergenic
940397869 2:153213239-153213261 GGGTCATTCCACAACCCCCATGG - Intergenic
942944255 2:181656548-181656570 GCCCCATCCCAGAACCCCCAGGG - Intronic
946496289 2:220199271-220199293 TTGCCATCCCCAAACCCCCAGGG + Intergenic
947587221 2:231363931-231363953 GTGCCTTCCCCCAACCCCCATGG + Intronic
948045490 2:234940567-234940589 CTGCCCTCCCAGAACCCCTAGGG + Intergenic
948771189 2:240251950-240251972 GGGCCAGCCCAGCACCCCTGGGG - Intergenic
1168767568 20:392061-392083 GCTCCATCCCAGAATCCCAAGGG - Intronic
1171225394 20:23438317-23438339 GGGCCATATTAGAAACCCCATGG - Intergenic
1172844257 20:37920376-37920398 GGGCCAGCCCAGCAGCCCCGTGG - Intronic
1173217879 20:41103594-41103616 AGGCCATCCCTGAACCCCAGAGG - Intronic
1174513643 20:51074919-51074941 GGGGCATCCCAGAAGCCTCTGGG - Intergenic
1174952179 20:55054266-55054288 GGGCCAACCCAGATAACCCAGGG + Intergenic
1175056624 20:56204571-56204593 GGGCCATTCTGGGACCCCCAGGG + Intergenic
1175204785 20:57303220-57303242 GAGCCATCCCTGATTCCCCAAGG + Intergenic
1175762966 20:61573593-61573615 GGGCCATCCCAGGAGCCTCGGGG + Intronic
1175942152 20:62542329-62542351 CAGCCAACCCAGAACCCCCCGGG - Intergenic
1176001108 20:62831562-62831584 GGGCCATGCCAGCAACCTCAGGG + Intronic
1176059116 20:63164507-63164529 CGGCTCTGCCAGAACCCCCAGGG + Intergenic
1176413251 21:6460099-6460121 GATCCATCCCAGGACCCCCCAGG + Intergenic
1178036244 21:28586482-28586504 CTGCCATCTCAAAACCCCCATGG + Intergenic
1179688748 21:43068421-43068443 GATCCATCCCAGGACCCCCCAGG + Intronic
1180801408 22:18633830-18633852 GGCCCAGGCCGGAACCCCCAGGG + Intergenic
1182908320 22:33957711-33957733 GGGCCTTCCCAGAAGCCCAGTGG + Intergenic
1183361684 22:37386272-37386294 GAGCCATTCCAGAAACCCCAGGG - Intronic
1183485628 22:38086360-38086382 TGGCCATCCCAGTACTCCGAGGG + Exonic
1184188155 22:42878146-42878168 TGGCCAGCCCAGGGCCCCCAGGG + Intronic
1184659127 22:45957820-45957842 GGCCCAGCCCAGCAGCCCCATGG - Intronic
1185182566 22:49371825-49371847 TGGGCATCCCAGCGCCCCCAAGG - Intergenic
1185344971 22:50307125-50307147 GGGCCGTCCCCGCACCCCCTGGG - Intronic
950446992 3:13044209-13044231 GGGTCATCCCCCCACCCCCAGGG + Intronic
953622698 3:44546898-44546920 GGGCTATCCCTAAACCCTCAGGG + Intergenic
954105548 3:48407893-48407915 GGGCCACACCAGGACCCGCAGGG - Intronic
954649059 3:52149152-52149174 GGGCCAGCCCCCAACCCCCAGGG + Intronic
957651671 3:83014290-83014312 GGGCTATACCAGCAGCCCCAGGG + Intergenic
958675677 3:97265601-97265623 GGGCCTTCCCAAGACCCCGAGGG + Intronic
961215241 3:125154589-125154611 GGTACATCCCATGACCCCCAGGG + Intronic
967007419 3:185397779-185397801 GGTCCACCCCACAACCCTCATGG - Intronic
967960085 3:194913387-194913409 GGCCCATCCCAGAAGCAGCATGG - Intergenic
968642106 4:1720096-1720118 GGCCCAGCCCAGCACCCCCCTGG + Intronic
969401912 4:6961407-6961429 GGGCCAGCTCAGCTCCCCCATGG - Intronic
969445574 4:7243041-7243063 GAGCCAACCCTCAACCCCCAGGG - Intronic
969477619 4:7430493-7430515 GGGACGTCCCAGAACACCTATGG - Intronic
969651199 4:8469316-8469338 GGGCCAACCCAGAGGCCCCACGG - Intronic
979030544 4:115639026-115639048 GCGCCCTCACAGAACACCCAGGG - Intergenic
979940662 4:126758621-126758643 GGGCCGTGCCAGAAAACCCAGGG - Intergenic
981245813 4:142536680-142536702 GGGCCATCTCAGTACCCAGAAGG + Intronic
983562789 4:169117666-169117688 GGGCCTGCCCAGAAGCTCCAGGG - Exonic
985745185 5:1642765-1642787 TGGCCCTCCCACAGCCCCCAGGG - Intergenic
985745205 5:1642834-1642856 TGGCCCTCCCACAGCCCCCAGGG - Intergenic
985950169 5:3217039-3217061 GGGCCCACCTAGAACCCCGAGGG + Intergenic
985999498 5:3619505-3619527 GGGCCAGCCCATGACCCCCGAGG + Intergenic
986176379 5:5355542-5355564 GGACCATCCCAGAATCCCTGGGG - Intergenic
990399946 5:55428213-55428235 GGGGCATCCCAGAATTCTCACGG - Intronic
990617554 5:57522834-57522856 GGGCCATCCCTGAACCCTTGGGG + Intergenic
994061007 5:95476250-95476272 GGGACATTCCAGTGCCCCCAGGG - Intronic
996350896 5:122540437-122540459 AGGTCATCCAAGAAACCCCAGGG + Intergenic
996688582 5:126311995-126312017 TGGCCATCCCAGAACCATCTGGG + Intergenic
996901223 5:128543570-128543592 AGGCCATCCCACCACCACCAAGG + Intronic
997293104 5:132751973-132751995 GGGCCAGCTCAGGACCACCAGGG - Exonic
998152132 5:139763575-139763597 GGGCCAGCCCCTCACCCCCAGGG + Intergenic
998891490 5:146751023-146751045 GAGCCATCCCTGACCTCCCAGGG - Intronic
999282385 5:150374244-150374266 GGGCTACCCCAGCACCCCCTGGG + Exonic
1001330833 5:170761253-170761275 GGGCCATCCCAGACTCCCTCTGG + Intergenic
1001650091 5:173309963-173309985 GGGTCATCCCAGCGCCTCCAAGG - Intergenic
1001954426 5:175838586-175838608 GGGGCAGCCCAGAAACCCCTGGG - Intronic
1003729376 6:8804072-8804094 GAGCCATCCCTGAACCCTCATGG + Intergenic
1010192469 6:73208641-73208663 GGACCCTCCTAGAAGCCCCAGGG - Intergenic
1012276669 6:97282948-97282970 GGGCCAACCCCGACCCTCCAAGG + Intronic
1016868691 6:148795640-148795662 CGCCCATCCCACAACCCCAATGG - Intronic
1018650901 6:165990386-165990408 GGGCCTTCCTAGAACCCACCAGG + Intergenic
1019043020 6:169121674-169121696 GGGCCATCTCAGAATCCCTGAGG - Intergenic
1019539233 7:1544306-1544328 GGGCCAGGCCAGGGCCCCCAGGG + Exonic
1020278541 7:6638239-6638261 GGGCCATCTCAGGTTCCCCAGGG - Intronic
1022288053 7:28974362-28974384 GGGCCATGGCAGAATCCTCACGG + Intergenic
1022471061 7:30682177-30682199 GGGCCACCCCTGGACCCCGAGGG - Intronic
1022516538 7:30978276-30978298 TGCCCCTCCCAGGACCCCCAGGG - Intronic
1022616858 7:31940583-31940605 GGGACCTCCCAGAACCCATAGGG + Intronic
1023818766 7:43968880-43968902 GGGCCACCCCCCAACCCCCAGGG - Intergenic
1024891610 7:54210547-54210569 GGGCAATGCCAGCACCCCCTTGG - Intergenic
1026291019 7:69006210-69006232 AGGCCAACCCACAACACCCAAGG + Intergenic
1027218980 7:76202127-76202149 GGGCCTCCCCAGCACCCCCGTGG + Intronic
1029561832 7:101308251-101308273 GGGCCGACCCAGACCCTCCAGGG + Intergenic
1029743815 7:102505846-102505868 GGGCCACCCCCCAACCCCCAGGG - Intronic
1029761802 7:102605009-102605031 GGGCCACCCCCCAACCCCCAGGG - Intronic
1030621555 7:111796085-111796107 GGGACCTCCCAGATGCCCCAGGG - Intronic
1033595637 7:142856056-142856078 GGTCCATGCCAGCTCCCCCAGGG - Intronic
1034502992 7:151463477-151463499 AGGCCATCCTAGAAGCCCCTGGG + Intergenic
1035488727 7:159253206-159253228 GGGCCATCCCAGCAACCCACAGG + Intergenic
1037433725 8:18841326-18841348 GGGCCTCCCCAGCACTCCCAAGG - Intronic
1037519986 8:19671235-19671257 GGGCCATCTTAGAACCTTCAGGG - Intronic
1040285851 8:46100023-46100045 GAGCCCCCCCAGAATCCCCAGGG + Intergenic
1040303382 8:46199712-46199734 CTGCCATCCCAGAAGCCCCCAGG + Intergenic
1040303723 8:46201436-46201458 TGCCCATCCCAGAAGCCCCAAGG + Intergenic
1040303911 8:46202328-46202350 CTCCCATCCCAGAAGCCCCAAGG + Intergenic
1040304740 8:46206222-46206244 CTCCCATCCCAGAACCCCCCAGG + Intergenic
1040307088 8:46217666-46217688 GTCCCATCCCAGAAGCCCCCAGG - Intergenic
1040313423 8:46248611-46248633 CTCCCATCCCAGAAACCCCAAGG + Intergenic
1040313982 8:46251295-46251317 CTGCCATCCCAGAAACCCCCAGG + Intergenic
1040333262 8:46403188-46403210 CTCCCATCCCAGAAGCCCCAGGG + Intergenic
1040335080 8:46412011-46412033 CTGCCATCCCAGAAGCCCCAGGG + Intergenic
1040338154 8:46426674-46426696 GGGTTATCCCAGAAGCCCCCAGG + Intergenic
1040338260 8:46427108-46427130 CTCCCATCCCAGAAGCCCCAAGG + Intergenic
1040340108 8:46436125-46436147 GTCCCATCCCAGAAGCCCCCAGG - Intergenic
1041396705 8:57399104-57399126 GGGGTTTCCCAGAACCCCAAGGG + Intergenic
1041663679 8:60422661-60422683 GGGCTATCCCTGAACCCCTGGGG + Intergenic
1045648824 8:104324414-104324436 GGCCCAGCCCAGAACATCCAGGG + Intergenic
1046737676 8:117794378-117794400 TGTCTACCCCAGAACCCCCAAGG + Intergenic
1049592018 8:143466881-143466903 GGGTCTGCCCAGATCCCCCAGGG - Intronic
1049813293 8:144585911-144585933 GGGGCATCCCTGCACCCCCATGG + Intronic
1049856377 8:144864535-144864557 GGGCTGTCCCAGAACCCCTGTGG + Intergenic
1051206481 9:14693730-14693752 GGGACATCCCAGAACACCTGCGG - Intergenic
1052442444 9:28515072-28515094 TGGCCATCCAAGAACCCTGATGG + Intronic
1053142259 9:35689560-35689582 GGGCCTTCGCAGTACCCTCAGGG - Intronic
1057410712 9:94814601-94814623 GGGCCATCCCTGAAGCCCTGAGG + Intronic
1060986107 9:127819823-127819845 GTGCCCTCCCTGATCCCCCAGGG - Intronic
1060994132 9:127866736-127866758 GGGACACCCCAGAATCCCCTGGG - Exonic
1061052348 9:128204053-128204075 GGGACATCCCCCTACCCCCATGG + Intronic
1062398754 9:136363337-136363359 GCTCCCTCCCAGAAGCCCCAAGG + Intronic
1186435983 X:9543509-9543531 GGGGCATCCCAGCCCACCCATGG + Intronic
1188244254 X:27821472-27821494 GGGGCATCCAACAATCCCCATGG + Exonic
1189901533 X:45711876-45711898 TGGCCTTACCACAACCCCCAAGG - Intergenic
1191641279 X:63431496-63431518 GGGCTATCCCGGAACCCCTGTGG + Intergenic
1191937837 X:66443936-66443958 GGGACTTCCAAGAACCTCCAGGG - Intergenic
1192633166 X:72792325-72792347 AGGCCAGGCCAGAATCCCCAGGG - Intronic
1192648543 X:72928476-72928498 AGGCCAGGCCAGAATCCCCAGGG + Intronic
1194438154 X:93894746-93894768 GGGCAATACCAGCACCCCCTTGG + Intergenic
1196436161 X:115676506-115676528 TGGACTTCCCAGAACCACCATGG + Intergenic
1200210707 X:154345575-154345597 GGGCCTCCCCAGATCCCCCCCGG + Intergenic
1200220145 X:154386517-154386539 GGGCCTCCCCAGATCCCCCCCGG - Intergenic