ID: 902813158

View in Genome Browser
Species Human (GRCh38)
Location 1:18901146-18901168
Sequence GTGCAGGGAAGGCCTGCAAA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 292
Summary {0: 1, 1: 0, 2: 1, 3: 19, 4: 271}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902813153_902813158 -3 Left 902813153 1:18901126-18901148 CCATCTTCCTGAGTCTCAGAGTG 0: 1
1: 0
2: 15
3: 45
4: 329
Right 902813158 1:18901146-18901168 GTGCAGGGAAGGCCTGCAAACGG 0: 1
1: 0
2: 1
3: 19
4: 271
902813156_902813158 -10 Left 902813156 1:18901133-18901155 CCTGAGTCTCAGAGTGCAGGGAA 0: 1
1: 0
2: 2
3: 33
4: 304
Right 902813158 1:18901146-18901168 GTGCAGGGAAGGCCTGCAAACGG 0: 1
1: 0
2: 1
3: 19
4: 271

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902813158 Original CRISPR GTGCAGGGAAGGCCTGCAAA CGG Intronic
900369099 1:2323612-2323634 GTGCAGCGAGGGCCTGGAGAAGG - Intronic
902218207 1:14947894-14947916 GGGCAGGAAAAGCCTGGAAATGG + Intronic
902359977 1:15937137-15937159 GTGTAGGGAAGGAAGGCAAAGGG - Intronic
902813158 1:18901146-18901168 GTGCAGGGAAGGCCTGCAAACGG + Intronic
904593300 1:31627313-31627335 CTCCAGGGAAGGCCTGTAATTGG - Exonic
904609650 1:31718408-31718430 GTGCACGGCAGGCCAGCTAAGGG + Intergenic
905224772 1:36472037-36472059 GTGGAGGGATGGCCTTCAGAGGG + Intronic
905366560 1:37454791-37454813 GTCCATAGAAGGCCTGCATAGGG + Intergenic
905891160 1:41519207-41519229 GTTCAGGGAAGGCCTGGGCAAGG + Intronic
907355964 1:53874108-53874130 GTTCAGTGAAGGGTTGCAAACGG - Intronic
908021418 1:59902186-59902208 GGTCAGGGAAGGCTTCCAAAAGG - Intronic
908983330 1:69985062-69985084 GAACAGGGAAGGGCTGCAAATGG - Intronic
910559015 1:88569701-88569723 ATGCAAGGATGGCCTGGAAATGG - Intergenic
912514123 1:110207444-110207466 GTGGAGGGGGGGCCTGGAAAGGG + Intergenic
913239276 1:116815138-116815160 GTTCCAGGAAGGCCTGAAAAAGG + Intergenic
916328542 1:163591264-163591286 TTCCAGGGAAGGCATACAAATGG - Intergenic
916533470 1:165680557-165680579 GTGCAGGGAGGGGCTGCCACAGG - Exonic
918644582 1:186888757-186888779 GGGAAGGGGAGGCATGCAAATGG - Intronic
919570591 1:199243135-199243157 AGGCAGGAGAGGCCTGCAAAGGG + Intergenic
920336110 1:205246500-205246522 GTGGAGGCTAGGCTTGCAAATGG - Intronic
920817294 1:209346526-209346548 GGGCTGAGAAGGCCTGCAAGAGG + Intergenic
921275358 1:213513665-213513687 GTGCATGGCAGGCATTCAAATGG - Intergenic
921710158 1:218365617-218365639 TTGCAGGGAAGGTCTGAAAGGGG - Intronic
922047504 1:221960761-221960783 ATCTAGGGAAGGCCTTCAAAAGG - Intergenic
922579171 1:226684405-226684427 CTGCATGGAAGGCCTGCATTTGG + Intronic
922866654 1:228866347-228866369 TTGCAGGGCAGGCCTAGAAAGGG + Intergenic
1062988321 10:1790682-1790704 GTGCAGGGAAGCCCTCCAGGTGG + Intergenic
1065609742 10:27461209-27461231 ATCCAGGAAAGGCCTGCAAAGGG + Intergenic
1065908535 10:30281150-30281172 ATCCAGGAAAGGCCTGGAAAAGG + Intergenic
1067399257 10:45955997-45956019 GATCAGGGAAGACCTGGAAAGGG - Intergenic
1067790874 10:49286820-49286842 GGGCACCGGAGGCCTGCAAAGGG + Intergenic
1067837051 10:49648022-49648044 GGGAGGGGAGGGCCTGCAAAGGG + Intronic
1067867576 10:49925213-49925235 GATCAGGGAAGACCTGGAAAGGG - Intronic
1067939319 10:50640347-50640369 GGCCAGGGAAGGCTTGTAAAAGG + Intergenic
1068066937 10:52143579-52143601 GTGCAGGAAAGCTCTGTAAAGGG + Intronic
1069615972 10:69806358-69806380 CTGCAGGGAGGGCCGGCCAAGGG + Intronic
1069994407 10:72333689-72333711 CAGAAGGGAAGGCCTGCAGAGGG - Exonic
1070288722 10:75101087-75101109 GTGGGGAGAAGGCCTGCAGAAGG + Intronic
1072234227 10:93439187-93439209 TTGCAGGTAACACCTGCAAAGGG + Intronic
1074720290 10:116258014-116258036 GGTCAGAGAAGGCTTGCAAAAGG - Intronic
1075209152 10:120476214-120476236 CTGGAGGCAAGGCCTGCACAGGG - Intronic
1075431399 10:122385119-122385141 GTGAAGGGAAGGACTGTAAGTGG - Intronic
1075827420 10:125370961-125370983 GTGCAGAGGAGGCCTGTAAGCGG + Intergenic
1076064993 10:127441732-127441754 GTGCAGGGGAGGCCCGCAGGGGG - Intronic
1076465724 10:130680359-130680381 GAGGAGGGAGGGTCTGCAAATGG + Intergenic
1076608020 10:131701894-131701916 GGGCAGGGAAGGTCTGCACAGGG - Intergenic
1076704649 10:132294417-132294439 CTGGAGGGGAGGCCTGCAGACGG + Intronic
1077515948 11:3002343-3002365 GTGCAGGGAAGGCCTGGCCAAGG - Intronic
1077921938 11:6647822-6647844 GGGCAAGGGAGGCCTGAAAAAGG + Intronic
1078096578 11:8301092-8301114 GTGCTGAGCAGGCCTGGAAATGG + Intergenic
1080264673 11:30388416-30388438 GTGCTGGGAAGGCCTGCCTTAGG + Intronic
1080746361 11:35111796-35111818 GAGCAGGGAAGATCTGCCAAGGG - Intergenic
1081352018 11:42065975-42065997 GGGAAGGGAAGGGCTGCGAAAGG + Intergenic
1082014397 11:47473651-47473673 ATGCAGGGAATGACTACAAAGGG + Intronic
1084337968 11:68472230-68472252 GGGAAGGGAAGGCGTGCAGACGG + Intronic
1084892482 11:72243499-72243521 GTGAGGGGAAGGCCTGGTAAGGG + Intronic
1085963816 11:81496764-81496786 TTGAAAGCAAGGCCTGCAAAGGG - Intergenic
1086500127 11:87444326-87444348 GAGAAGGGAAGGCGTGCATAAGG - Intergenic
1086598801 11:88607471-88607493 GTGCAGGGAAGATGGGCAAAAGG - Intronic
1088000643 11:104876182-104876204 GAGAAGAGAAGGGCTGCAAATGG + Intergenic
1089140529 11:116280469-116280491 GTGTTGGGAAGGCCTGGAGAAGG - Intergenic
1089634025 11:119800896-119800918 GTGCAGGGCTGGGCTGGAAAGGG + Intergenic
1090719095 11:129456306-129456328 GAGGAGGGAAGGCGTGCTAATGG - Intergenic
1091461788 12:648599-648621 GTCCAGGAAAGGCCTGGACAAGG + Intronic
1091685209 12:2556491-2556513 ATGAAGGGAAGACCAGCAAAAGG - Intronic
1092936481 12:13368514-13368536 GTGCAGGGAGGGGCAGCCAAGGG + Intergenic
1093478018 12:19575947-19575969 GTGCTGGTCAGGGCTGCAAATGG + Intronic
1094115424 12:26906785-26906807 GAGCATGGGAAGCCTGCAAATGG - Intronic
1094856837 12:34406619-34406641 GTGGAAGGAAGGCTTGCAAGGGG + Intergenic
1095822173 12:46490167-46490189 GTTCATGGAAGTCCTTCAAAAGG + Intergenic
1095938694 12:47711778-47711800 GTGGAGGGAAGGGCAGAAAAGGG + Intronic
1097007227 12:55928037-55928059 GCGCAGGGCAGGACTACAAATGG - Intronic
1100079628 12:90832499-90832521 GTGCAGGGCTGGCCTTCAACAGG + Intergenic
1104313990 12:127680081-127680103 ATCCAGGAAAGGCCTGGAAAGGG - Intergenic
1104591013 12:130084713-130084735 GTGCTGGGAAGGCCTGTAGCAGG + Intergenic
1104621482 12:130316923-130316945 ATGGAGGGAAGCCCAGCAAATGG + Intergenic
1104775172 12:131386476-131386498 GGGCCGGTAAAGCCTGCAAAAGG + Intergenic
1105698438 13:22914729-22914751 GTGGAGGGAAGGATTACAAAGGG + Intergenic
1105850100 13:24326969-24326991 GTGGAGGGAAGGATTACAAAGGG + Intergenic
1108428770 13:50333122-50333144 GTGCAAGGAATGCCTGCAGCAGG + Intronic
1114049983 14:18914472-18914494 GTACAGGGAATGCCTGAAGAGGG + Intergenic
1114659346 14:24334796-24334818 CCGCAGGGAGGGCCTGAAAAAGG - Intronic
1115990979 14:39149606-39149628 GTGCATGGAAGTCCTGGTAAAGG - Exonic
1117004198 14:51402178-51402200 TTGAAGAGAATGCCTGCAAATGG + Intergenic
1118317159 14:64732368-64732390 GGGCAGGGAAGGCCGGCACATGG + Intronic
1118601220 14:67472578-67472600 GTGGAGGGAAGGGCTGCAAGGGG + Exonic
1120507046 14:85365748-85365770 GAGCATGGAATGCCTCCAAAAGG + Intergenic
1121668010 14:95686909-95686931 CTGCTGGGAAGGCCCACAAATGG + Intronic
1121818087 14:96943622-96943644 GTGCAGGGCTGGCGTGCAAGGGG + Intergenic
1121944622 14:98107666-98107688 GTGATCGGAAGGCCTGGAAAGGG + Intergenic
1122011324 14:98751370-98751392 GTGCAGAAAAGGCCTGGAGAAGG + Intergenic
1122075682 14:99233215-99233237 CTGCAGGGAAGGCCTACATAGGG - Intronic
1122840049 14:104454942-104454964 TTGCAGGGAAGGATTACAAAGGG + Intergenic
1122995542 14:105261927-105261949 GAGCAGGGGGGGCCTGCAGAAGG - Intronic
1123002160 14:105301338-105301360 GTGGAGAGACGGCCTGCGAAGGG + Exonic
1123114787 14:105889789-105889811 CTGCAGGGAGGGGCTGCACAGGG + Intergenic
1202875357 14_GL000225v1_random:202531-202553 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1202877835 14_KI270722v1_random:23755-23777 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1123823355 15:24055165-24055187 ATGCAGGGAAGGGTAGCAAATGG - Intergenic
1125602093 15:40921067-40921089 GAGAAGAGAAGGCATGCAAAAGG - Intergenic
1126644206 15:50858908-50858930 GTGTATGCAAGGACTGCAAATGG - Intergenic
1126806083 15:52350676-52350698 AGGCAGGGAAGGACTTCAAAGGG + Intronic
1128683066 15:69665548-69665570 GTGCAGGTCAGGCCTGGAAGAGG + Intergenic
1128894857 15:71363460-71363482 GGGCAGGGGAGACCTGAAAAGGG + Intronic
1129608260 15:77035254-77035276 GTGCTGAGATGGCCTGCAGAGGG + Intronic
1130376990 15:83338022-83338044 GTGGAGGGAAGTCCTCCAAGTGG + Intergenic
1131066609 15:89438796-89438818 GTGCAGGGAAGCCATGTGAACGG - Intergenic
1131072268 15:89473313-89473335 GTGCAGGGAAGGCCAGAAGTGGG + Intronic
1132220746 15:100103279-100103301 GTGCAGGGAAGGGCAGCATGTGG + Intronic
1132752788 16:1466439-1466461 GTGCAGGAACGGCCTGCACTGGG + Intronic
1135568172 16:23528064-23528086 ATGCAGCGAAGGGCTGGAAAAGG + Intronic
1136069548 16:27779512-27779534 GTGCAGGGAGGGCCTGCTCAAGG - Exonic
1136549174 16:30973258-30973280 GTGCAGAGAAAGCTTGGAAAGGG + Intronic
1138271587 16:55699666-55699688 CTGCAGGGAAGTCCTGCATGTGG + Intronic
1138446562 16:57067856-57067878 GGGCAGGGCAGAGCTGCAAAGGG - Intronic
1141469088 16:84226353-84226375 GTGTAGGGATGGCCTGTGAAGGG + Intronic
1141765732 16:86058887-86058909 GGGCAGGGATTGCCTGAAAAGGG + Intergenic
1144859067 17:18288679-18288701 GTGCAGGGTAGGCCTGAGGAAGG - Intronic
1146140388 17:30362722-30362744 GTGCAAGGAGTGCCTGCATAGGG + Intergenic
1146832574 17:36082464-36082486 GTGCAGGGAACAACAGCAAAAGG + Intergenic
1146847054 17:36188776-36188798 GTGCAGGGAACAACAGCAAAAGG + Intronic
1149000631 17:51753683-51753705 GTGGAGGGAAGGCCTCCCACAGG + Intronic
1152450269 17:80374235-80374257 GTGCAGGGAATGCCTGCCGACGG - Intronic
1152471209 17:80490986-80491008 GTGAAGGGAAGGGCTGCAGGTGG - Intergenic
1152735233 17:81993971-81993993 CTGCAAGGAAGGCCTGAGAAGGG + Intronic
1154293266 18:13129198-13129220 CTGGAGGGAAGGACTGCACAAGG - Intergenic
1155162718 18:23208685-23208707 TTGTAGGGAAGCCCTGGAAAGGG - Intronic
1155172177 18:23275163-23275185 GTGCAGGGAGGGGCAGCAGAGGG + Intronic
1155281556 18:24245869-24245891 GTGCTAGGAAGGACTGAAAAAGG - Intronic
1156454865 18:37287226-37287248 GGGCAGGGAAGGGATGCAATGGG + Intronic
1156691147 18:39708349-39708371 GGGCAGGGAAGTGCTGGAAAGGG - Intergenic
1157246051 18:46056258-46056280 GGGCAGGGAAAGCCTGGAGAGGG - Intronic
1158030889 18:52963448-52963470 GTGAAGCAAAGACCTGCAAATGG + Intronic
1160798590 19:956840-956862 GTGCTGGGGAGGCCGGCCAAAGG - Intronic
1160854665 19:1211356-1211378 GAGCAGGGAAGGGCTGGAAAGGG + Intronic
1161260742 19:3336656-3336678 GTGCAGGGCAGGCCTGGGAGTGG + Intergenic
1163574189 19:18100957-18100979 GTGCAGGAAAGGTCTGAAAAAGG + Intronic
1164775698 19:30851940-30851962 ATGCAGGGAAGGCCTTCCTAGGG + Intergenic
1165245796 19:34497788-34497810 GAGCAGGGATGGTCTGCAGAGGG + Intronic
1202672843 1_KI270710v1_random:9188-9210 GCCCATGGAAGGCCTGCATAGGG - Intergenic
925096062 2:1204127-1204149 CTGGAGGGATTGCCTGCAAACGG + Intronic
925128591 2:1478509-1478531 GTGCAGTGAAGGCCAGAAAGCGG - Intronic
927680579 2:25136503-25136525 GTACTGGGAAGGGATGCAAAGGG - Exonic
928040630 2:27872967-27872989 TCGCAGAGAAAGCCTGCAAATGG + Intronic
931415105 2:62073255-62073277 ATGCAGGAAAGGCCTAGAAAGGG - Intronic
932452925 2:71827321-71827343 TTGCTGGGAAGACCTGCAAAGGG - Intergenic
934663315 2:96154470-96154492 CAGCAGGGAAGGCCTGCAGCTGG + Intergenic
936099127 2:109559850-109559872 TTGAAGGGAAGGCCTGCAACAGG - Intronic
937338839 2:121078028-121078050 GTGCGGGGAAGGCCTCGGAAGGG + Intergenic
938681312 2:133693886-133693908 GTGCAGCAAAAGCCTGCAAGCGG + Intergenic
938801856 2:134771147-134771169 GTACAGGGATGGATTGCAAAGGG - Intergenic
938941359 2:136172268-136172290 GTGCAGGAAAGGACTGAAAGAGG + Intergenic
938983140 2:136545847-136545869 GTGCAGGGAAGGCTTTTCAAAGG - Intergenic
939461623 2:142503597-142503619 GTGCAGGTAAAACCTGTAAAAGG + Intergenic
940102725 2:150060484-150060506 GTTTAGGGAAGGCCTTTAAATGG - Intergenic
944863814 2:203840995-203841017 GTGCTGGGAAGGGCTGCCACAGG - Intergenic
946547066 2:220755828-220755850 GTGTAGGGAAAGCCTTCATATGG + Intergenic
947134228 2:226961110-226961132 GTGAAAGCAAGGCTTGCAAAGGG - Intronic
948468796 2:238164518-238164540 GTGAAGGGAAGGCCTGATAGGGG - Intronic
948604366 2:239125503-239125525 GTGCAGGAATGGCCTGAAACAGG + Intronic
948947621 2:241229070-241229092 GTGCAAGGAAGACCTGGCAATGG - Exonic
1169525247 20:6417426-6417448 GACCAGGGCAGGCCTGAAAAGGG - Intergenic
1169689113 20:8310516-8310538 GGACAGGGATGGCCTGGAAAGGG + Intronic
1172533627 20:35653299-35653321 GTGCTGGGCAGGCCTGCACCGGG + Exonic
1174436641 20:50511341-50511363 GATCAGGGAAGGCCTGTCAAAGG + Intronic
1174715345 20:52751747-52751769 CTGCATGGAAGGCCAGGAAACGG + Intergenic
1176032000 20:63017254-63017276 GTGCAGGGTGGGCCTGAAGAAGG + Intergenic
1176357820 21:5967041-5967063 GTGAAGGGAGAGCCTGGAAAAGG + Intergenic
1176639123 21:9281190-9281212 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1177713258 21:24807360-24807382 GGGAAGGGAAGGTCTGAAAAGGG + Intergenic
1177893786 21:26837754-26837776 GGGCAGGGATGGTCTGCACAAGG + Exonic
1179765698 21:43571510-43571532 GTGAAGGGAGAGCCTGGAAAAGG - Intronic
1180043257 21:45291413-45291435 CTGCAGGGAAAACCTGCAACTGG + Intergenic
1180372430 22:12054033-12054055 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1180390038 22:12221619-12221641 GCCCATGGAAGGCCTGCATAAGG - Intergenic
1180423169 22:12888697-12888719 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1180971574 22:19818903-19818925 GGACAGGGAAGGCCTGCAGGGGG - Intronic
1182740551 22:32564227-32564249 GTGCAGTCATGGCCGGCAAATGG - Intronic
1183590267 22:38775813-38775835 GTGCAGGGGAGGCCTGGCGATGG + Intronic
1185053876 22:48567880-48567902 GTGCTGGGCAGGCCTGGGAACGG + Intronic
1185330523 22:50250205-50250227 GTGTGGGTATGGCCTGCAAAGGG - Intronic
950652622 3:14416678-14416700 GCACAGGGACGCCCTGCAAATGG + Intronic
951664305 3:25104906-25104928 GTGGAGGTAATGCCTGCAAGGGG + Intergenic
952827473 3:37536319-37536341 GTGCCTGGAAGGCCTGCCCAGGG - Intronic
952951366 3:38528178-38528200 GTTCAGGGATGGGCTGCTAATGG - Intronic
954218035 3:49135206-49135228 GTGCATGGCTGGCCTGCAATAGG - Intergenic
954423879 3:50433145-50433167 GGATAGGGAAGGCCTGCTAATGG - Intronic
955246189 3:57227545-57227567 GTGCAGGGAAGGCCATCCCAGGG + Intergenic
957101081 3:75829627-75829649 GCCCATGGAAGGCCTGCATAGGG - Intergenic
957773778 3:84729039-84729061 GTTTAGGGAAGACCTGGAAATGG - Intergenic
957827652 3:85469437-85469459 ATGCAGGAATGGCCTCCAAATGG + Intronic
958136249 3:89497275-89497297 GTGGAGTGAGGGACTGCAAAAGG - Intergenic
958570813 3:95879921-95879943 GTGCTAGAAAGGCCTGCTAAGGG + Intergenic
959096379 3:101961034-101961056 GTGCAGGGAAGGGAGGCTAAAGG + Intergenic
961459108 3:127039080-127039102 GGGCAGGGAAGGCCTGAGGAGGG + Intergenic
961633726 3:128319873-128319895 CTGCAGAGCAGGCCTGCAAGAGG - Intronic
962990728 3:140574847-140574869 CTGCAGAGAAGGCAGGCAAAGGG + Exonic
966058511 3:175727165-175727187 GTGCAGGGAAGGCATGCTCCAGG + Intronic
967073278 3:185980657-185980679 CTGGAGGGAAGGCCTGTGAAGGG + Intergenic
967970398 3:194994933-194994955 GGGCAGGGGCTGCCTGCAAAAGG - Intergenic
968233817 3:197019686-197019708 GTGCTGGGCAAGCCTGGAAATGG - Intronic
1202747772 3_GL000221v1_random:123829-123851 GCCCATGGAAGGCCTGCATAGGG - Intergenic
968802269 4:2751036-2751058 GGGCAGGCCAGCCCTGCAAAGGG + Intronic
969241689 4:5902925-5902947 ATGCAGGAAGGGCCTGCAACTGG - Intronic
971620155 4:28845412-28845434 GTCAAGGGAAGAGCTGCAAATGG + Intergenic
973209149 4:47596160-47596182 GTGCAGAAAATGCCTGAAAAAGG - Intronic
974322096 4:60364381-60364403 ATGCAGGGCAGCACTGCAAATGG + Intergenic
982300973 4:153879257-153879279 GTGAAGGGAAGGCCTCCCAGTGG + Intergenic
1202754020 4_GL000008v2_random:39603-39625 GCCCATGGAAGGCCTGCATATGG + Intergenic
985711646 5:1432847-1432869 ATGCAGGGAAGGCCCGTGAAAGG + Intronic
986670800 5:10140850-10140872 GTGCAGGGAAGGCCTGGAAGGGG + Intergenic
989646200 5:43635389-43635411 GTGCATGGAAGGCCAGGAAGTGG + Intronic
990285951 5:54300805-54300827 GTGCAGAGAAGGATTGGAAAGGG - Intronic
990487889 5:56277177-56277199 CTGCAGGGAAGGCCAGCAGCTGG - Intergenic
992322862 5:75631058-75631080 AGGCAGGTAAGGCCTGGAAATGG + Intronic
992526391 5:77615051-77615073 GAGCAGGGATTGACTGCAAATGG + Intronic
992955283 5:81901780-81901802 GTGCAGAAGAGGCCTGCAGAGGG + Intergenic
994213639 5:97112913-97112935 GTGCAGGGGAGGACTACACAAGG - Intronic
994959364 5:106578976-106578998 GTGCAGGGAATGTCAGCAAGTGG + Intergenic
995708225 5:115007572-115007594 TTGCAGGCCAGGCCTGGAAAGGG + Intergenic
995819459 5:116212427-116212449 TTGCAGAGCAGGCCTGCAAGGGG + Intronic
995866615 5:116698241-116698263 GTGGAGGAAATGCCAGCAAAGGG + Intergenic
998480503 5:142459039-142459061 GTGGAGGGGAGACCTGCAGAGGG + Intergenic
999156943 5:149464842-149464864 GTGCTGGAAGGGCCTGCAAGTGG - Intergenic
1001741115 5:174053426-174053448 CTGCAGGGGAGGCCTGAAAGGGG + Intronic
1001827680 5:174759143-174759165 GTACAGATAAAGCCTGCAAATGG + Intergenic
1003443662 6:6165813-6165835 GTGCAGGGTTGGCAGGCAAAGGG - Intronic
1004913824 6:20312864-20312886 ATGCAGGGAAAGCCAGCAGATGG - Intergenic
1006121590 6:31810072-31810094 GTGCCTGGAAGGCCTGCCACAGG - Exonic
1006848211 6:37077984-37078006 GTGCAAGGCAGGGCAGCAAAGGG - Intergenic
1006932396 6:37696167-37696189 GTTCAGGGAAGGTCCGAAAAGGG + Intronic
1011873595 6:91927280-91927302 GAGCAGGGAAGTGCTGGAAAGGG - Intergenic
1016751536 6:147635706-147635728 GTGCATGAAAGGCATGCCAAAGG - Intronic
1017442699 6:154478385-154478407 GTCCAGAGAAGGCCTCAAAAAGG - Intronic
1017769768 6:157636002-157636024 GTGCCGGGAACTCCTGCAAGGGG - Intronic
1018676603 6:166227613-166227635 GTGCAGGGATGGCCTCCCAATGG - Intergenic
1023141069 7:37102882-37102904 GAGCAGGAAAGGCCTTCACATGG + Intronic
1023632823 7:42180553-42180575 GTGGAGTGATGGCCTGGAAAAGG + Intronic
1024117207 7:46205734-46205756 TTGCAGGGAAGGCCTGCCCTTGG - Intergenic
1027050129 7:75016568-75016590 GTGGAGGGGAGGCCAGGAAAAGG - Intronic
1029382906 7:100225100-100225122 GTGGAGGGGAGGCCAGGAAAAGG + Intronic
1032060419 7:128719463-128719485 GAACAGGGAATGACTGCAAATGG - Intronic
1033197683 7:139341495-139341517 GTGCACGGAAAGCCTTCACAAGG - Exonic
1033591113 7:142809180-142809202 GGGGAGGGGAGGCCTGCACATGG - Intergenic
1033870569 7:145749951-145749973 GTGCAGGGAAGTGCTGGGAAAGG - Intergenic
1034003478 7:147442801-147442823 TTGCAGGTAGGGCCTGGAAAGGG + Intronic
1035738716 8:1909068-1909090 GTGCAGGGAAGAGCCGCACAGGG - Intronic
1036702978 8:11025448-11025470 GTGCAGGGAGGGGTTGCCAATGG + Intronic
1037980658 8:23250960-23250982 GTGCGGGGAAGGGGTGCAGATGG - Intronic
1038018937 8:23536761-23536783 ATGCAGGGAAGGCCTGCCTGTGG + Intronic
1038193438 8:25344673-25344695 GTAGAGGTAATGCCTGCAAAAGG + Intronic
1039076313 8:33693391-33693413 GGGCAGGGAAGTCCTGGGAAGGG - Intergenic
1039087708 8:33796284-33796306 ATGCACAGAGGGCCTGCAAAAGG - Intergenic
1039387478 8:37148891-37148913 GAGCAGGGTAGGTATGCAAAAGG - Intergenic
1040905346 8:52463959-52463981 CTGAAGGGAAGTCCTGCAGAAGG + Intergenic
1041632950 8:60108668-60108690 GGGCAGGGAAGGCCTGCCATGGG + Intergenic
1041782313 8:61590441-61590463 GGCCAGGGAAGCCATGCAAAGGG + Intronic
1041866935 8:62584737-62584759 GGTCAGGCAAGGCCTGTAAAAGG - Intronic
1042364911 8:67924951-67924973 TTGGAGGGAAAGCCTGCAAGAGG - Intergenic
1042573486 8:70192552-70192574 TGGCAGTGGAGGCCTGCAAAGGG + Intronic
1043277746 8:78420964-78420986 GCTCAGGGAAGGCCTCCAAGAGG + Intergenic
1044616279 8:94145769-94145791 GTACAGGGAAGGACTCCAGAGGG - Intronic
1047250334 8:123177481-123177503 GTTGAGGGAATGCCTGCACAGGG - Intergenic
1048550673 8:135431016-135431038 GAGCAGGAAAGGACTGCAGATGG - Intergenic
1048679838 8:136828886-136828908 GTGCAGTGAAGGCATGTAGAAGG - Intergenic
1050044383 9:1527876-1527898 GTGCTGGAATGGCCTGCCAAAGG - Intergenic
1051975186 9:22940600-22940622 ATCCAGGGAAGACCTGAAAAGGG - Intergenic
1052050947 9:23849604-23849626 GTGCAGGGAAGGGAGGCGAAGGG - Intergenic
1053234133 9:36437111-36437133 GTGAAGGAAAGGGCTGGAAAGGG - Intronic
1055929610 9:81546062-81546084 CTGCAGGGAAGGCTGGGAAATGG + Intergenic
1056822742 9:89854906-89854928 GTGGAGGGAAGGGCTGTAAGAGG + Intergenic
1057800891 9:98191198-98191220 GGGCAGGAAAGGCCTGCAGAGGG + Intronic
1058623771 9:106912993-106913015 GTGGAGGGAAGGCAACCAAATGG + Intronic
1058768560 9:108207698-108207720 GTGCATGGATGGGCTGCACACGG - Intergenic
1058774357 9:108269128-108269150 GGGCAGGGGAAGCCTGCAAATGG + Intergenic
1060562488 9:124557721-124557743 GTGCTGAAAAGGCCTGGAAATGG + Intronic
1060814082 9:126625734-126625756 CCGCAGGAAAGCCCTGCAAACGG - Intronic
1062088569 9:134661857-134661879 CTGGAGGGAAGGGCTGGAAAGGG - Intronic
1062488886 9:136794844-136794866 GTGCTGGGATGTCCTGCTAAGGG - Intronic
1203716407 Un_KI270742v1:153910-153932 GCCCATGGAAGGCCTGCATAGGG - Intergenic
1203534808 Un_KI270743v1:24329-24351 GCCCATGGAAGGCCTGCATAGGG + Intergenic
1186635043 X:11394383-11394405 GAACAGGGAATGACTGCAAATGG + Intronic
1187339301 X:18407100-18407122 CTGCAGGGCGGGCCTGCACACGG + Intergenic
1189663315 X:43326772-43326794 TGGTAGGGAATGCCTGCAAAGGG + Intergenic
1190133392 X:47771893-47771915 CTGGAGGAAAAGCCTGCAAAAGG + Intergenic
1191766655 X:64705559-64705581 GGGCAGGGAAGTCCTGGAAAGGG - Intergenic
1194957256 X:100195642-100195664 GTGTAAGGAAGACCTGCACATGG + Intergenic
1195504072 X:105636794-105636816 GTTCAGGGAAGGCTTCCCAAAGG + Intronic
1195562774 X:106302975-106302997 GAGCAGGGATGGACTGCAAATGG - Intergenic
1201886176 Y:18884793-18884815 GTGGAGGGTAGGCCTGAAAGAGG + Intergenic
1201966748 Y:19744968-19744990 TTGCAGGGAAGGACCGTAAAAGG + Intergenic
1202134032 Y:21641923-21641945 GAGGAGGAAAAGCCTGCAAAAGG + Intergenic