ID: 902813860

View in Genome Browser
Species Human (GRCh38)
Location 1:18904861-18904883
Sequence GAGTAGACACAGCCGGGGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 148}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902813848_902813860 21 Left 902813848 1:18904817-18904839 CCCTGGGGGGAACATAGCAAGGA 0: 1
1: 0
2: 0
3: 9
4: 158
Right 902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 148
902813845_902813860 28 Left 902813845 1:18904810-18904832 CCCAGGGCCCTGGGGGGAACATA 0: 1
1: 0
2: 2
3: 15
4: 160
Right 902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 148
902813844_902813860 29 Left 902813844 1:18904809-18904831 CCCCAGGGCCCTGGGGGGAACAT 0: 1
1: 0
2: 2
3: 38
4: 222
Right 902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 148
902813843_902813860 30 Left 902813843 1:18904808-18904830 CCCCCAGGGCCCTGGGGGGAACA 0: 1
1: 0
2: 2
3: 41
4: 319
Right 902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 148
902813853_902813860 -8 Left 902813853 1:18904846-18904868 CCCAGGCTTGGCCTGGAGTAGAC 0: 1
1: 0
2: 0
3: 17
4: 164
Right 902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 148
902813849_902813860 20 Left 902813849 1:18904818-18904840 CCTGGGGGGAACATAGCAAGGAC 0: 1
1: 0
2: 2
3: 18
4: 113
Right 902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 148
902813854_902813860 -9 Left 902813854 1:18904847-18904869 CCAGGCTTGGCCTGGAGTAGACA 0: 1
1: 0
2: 3
3: 11
4: 178
Right 902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 148
902813846_902813860 27 Left 902813846 1:18904811-18904833 CCAGGGCCCTGGGGGGAACATAG 0: 1
1: 0
2: 1
3: 11
4: 225
Right 902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG 0: 1
1: 0
2: 0
3: 13
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902813860 Original CRISPR GAGTAGACACAGCCGGGGCT GGG Exonic
900487784 1:2931654-2931676 GAGGGGACACAGACGGGGCCGGG + Intergenic
900737330 1:4307365-4307387 GGGCAGACACAGAAGGGGCTTGG - Intergenic
901188339 1:7389175-7389197 GAGAAGAGACAGCTGGGGGTGGG - Intronic
901629521 1:10641409-10641431 GCGTAGACACCACCCGGGCTCGG - Intronic
901756613 1:11445048-11445070 GAGTAGATACATCTGGGGGTTGG + Intergenic
902813860 1:18904861-18904883 GAGTAGACACAGCCGGGGCTGGG + Exonic
904371310 1:30049143-30049165 AAGGAGAAACAGCTGGGGCTGGG - Intergenic
904784237 1:32973409-32973431 CAGCAGACACAGCGGGGGATGGG + Intergenic
905371592 1:37485387-37485409 GTGCAGAGACAGCGGGGGCTTGG - Intergenic
913294272 1:117303735-117303757 GAATAGACCCAGCTGAGGCTGGG + Intergenic
913997067 1:143660473-143660495 GAGGAGACACAGCCGGGTGTGGG + Intergenic
914845643 1:151282352-151282374 GGGTAGAGACCGCCGGGTCTCGG + Exonic
915949056 1:160175754-160175776 GAATGGAAACAGCCAGGGCTTGG - Intronic
915962520 1:160279073-160279095 GGGGAGAAACAGCCTGGGCTGGG - Exonic
924022723 1:239801322-239801344 AAGTAGGTACAGCCAGGGCTAGG + Intronic
1063034458 10:2271717-2271739 GAGTAGACACAGCTTGGCCAAGG + Intergenic
1063953936 10:11248346-11248368 GACTAGACACAGCGGGGCCGAGG - Intronic
1067719772 10:48719616-48719638 GAGGAGAAACAGGAGGGGCTGGG + Intronic
1071060807 10:81569796-81569818 AAGGAGACACAGCCTTGGCTTGG + Intergenic
1072781544 10:98255119-98255141 GAGAACACACAGCTGGGCCTTGG + Intronic
1075780780 10:125015897-125015919 GTGTGGACACACACGGGGCTGGG + Intronic
1076788224 10:132762034-132762056 GAGTAGACACAGCTGGAGAAGGG + Intronic
1076827283 10:132975382-132975404 GAGGAGACACAGCCTGCGCCGGG - Intergenic
1077489171 11:2852656-2852678 GAGTGCAGACAGCCGGGGCCAGG + Intergenic
1078281886 11:9910751-9910773 TAGAAAACACAGCTGGGGCTGGG + Intronic
1078594815 11:12676358-12676380 GTGTAGTCACAGCCGGGAGTGGG + Intronic
1080415824 11:32069054-32069076 GAGTGGACACAGCCCGTGCAGGG + Intronic
1090382667 11:126337956-126337978 GGGCAGACACAGCCTGGGTTTGG + Intronic
1090981287 11:131724802-131724824 GAGCAGGCACAGCCTGGGGTGGG + Intronic
1091817997 12:3454135-3454157 GTGAAGAGACAGCAGGGGCTAGG - Intronic
1100186665 12:92146269-92146291 GAGTAGACACAGCCTGCGCCAGG - Intergenic
1102372762 12:112396058-112396080 GAAAAGACACAGACTGGGCTGGG + Intergenic
1105929778 13:25041601-25041623 GGGTAGACACAACCAGAGCTAGG + Intergenic
1107282817 13:38755945-38755967 ATGTAGACACAGCTGTGGCTTGG - Intronic
1108020356 13:46121802-46121824 GAGTAGACACTGCAGGGCCTTGG + Intergenic
1109996576 13:70134940-70134962 GAGTCCACACAGCCTGTGCTGGG - Intergenic
1110055103 13:70958014-70958036 AAGAAGACACAGACGGGGCAAGG + Intergenic
1113633031 13:111900784-111900806 GAGCAGACACAGCCGCAGCAAGG + Intergenic
1113755452 13:112808190-112808212 GAGGGGACACAGCCAGGGATGGG - Intronic
1114777321 14:25498641-25498663 GAGTAGCCAGGGCAGGGGCTGGG + Intergenic
1117282112 14:54251612-54251634 GAATGGACACAGCTGGGACTGGG - Intergenic
1117285613 14:54283115-54283137 GGGGAGGCACAGCTGGGGCTGGG - Intergenic
1119036282 14:71232507-71232529 GGGTAGTCACAGCCCTGGCTTGG - Intergenic
1119175045 14:72562649-72562671 GAGTCCACAGAGCCTGGGCTGGG + Intronic
1119430577 14:74565682-74565704 CTGTAGACACAGTTGGGGCTGGG + Intronic
1122796847 14:104210313-104210335 GAGCAGACAGAGCCGGGCCACGG - Intergenic
1122984429 14:105205678-105205700 GAGGACACACTGCCAGGGCTGGG + Intergenic
1202903177 14_GL000194v1_random:54725-54747 GAGCAGCTACAGCCGGGTCTGGG + Intergenic
1127455884 15:59155724-59155746 GAGGAGACAGAGCCGGGTCAAGG + Intronic
1127582839 15:60353373-60353395 GAGGAGACACAGCCAGGGACAGG - Intronic
1129737466 15:77974200-77974222 GAGTAGACACAGCCTGGTGCAGG + Intergenic
1129848607 15:78779426-78779448 GAGTAGACACAGCCTGGTGCAGG - Intronic
1130253316 15:82314520-82314542 GAGTAGACACAGCCTGGTGCAGG + Intergenic
1130306252 15:82713948-82713970 GAGGTGGCACAGCCAGGGCTGGG - Intergenic
1130335967 15:82957674-82957696 GATTGGAAACAGCAGGGGCTAGG - Intronic
1130856838 15:87846951-87846973 GAGTAGTCGCAGCCAGGGCCTGG - Intergenic
1134308696 16:13056903-13056925 AAGTAGACACAGCGGGGCTTAGG + Intronic
1138421989 16:56904894-56904916 CAGTAGGAACAGCCAGGGCTAGG - Intronic
1139148071 16:64346110-64346132 GAGTAGTCACAGCCCTGGCTTGG - Intergenic
1140132616 16:72177010-72177032 GAGTAGAAACAGCCAGGGTCAGG + Intergenic
1141967115 16:87453030-87453052 GAGTGGACACAGCCTGGGAGGGG + Intronic
1143727422 17:8858970-8858992 GAGCAGACACAGCCCAGGCAGGG - Intronic
1145912030 17:28548486-28548508 GAGTCCACAGAGCTGGGGCTTGG - Intronic
1147228125 17:38996627-38996649 GGGTAGGCCCAGCCGTGGCTTGG - Intergenic
1149610690 17:57955857-57955879 GAGGACGCACAGCTGGGGCTTGG + Intergenic
1149755648 17:59183247-59183269 GAGAAGACACAGCCTCTGCTGGG - Intronic
1151254200 17:72863024-72863046 CAGTAGACCCAGGCAGGGCTTGG + Intronic
1151460483 17:74251433-74251455 GAGTTGGCACATCAGGGGCTTGG + Intronic
1151517136 17:74603904-74603926 CAGCAGACACAGCTGGGCCTGGG + Intergenic
1153239852 18:3021183-3021205 TAGTAGAGACAGGCGGGGCGCGG - Intergenic
1153358389 18:4164383-4164405 GATCAGACACTGCCGGGGCTGGG + Intronic
1154497775 18:14975065-14975087 GAGTCCCCACAGCAGGGGCTGGG - Intergenic
1160960950 19:1720586-1720608 GAGAAGACGCAGACAGGGCTCGG - Intergenic
1162087117 19:8255602-8255624 CAGGAGAGACAGCTGGGGCTGGG - Exonic
1163255377 19:16153018-16153040 GCGGAGACACTGCGGGGGCTGGG - Intronic
1163582219 19:18145666-18145688 CAGCAGACCCAGCCTGGGCTGGG + Intronic
1166415035 19:42589166-42589188 CAGTAGAAACAGCGGGGGTTTGG - Intronic
1167454340 19:49590694-49590716 AAGATGGCACAGCCGGGGCTGGG - Exonic
1168146000 19:54420479-54420501 GTGGAGGCCCAGCCGGGGCTGGG + Intronic
927843372 2:26458882-26458904 GGGGACACAGAGCCGGGGCTTGG + Intronic
929668872 2:43853805-43853827 GAGGAGTCACAGCCAGGGCTGGG - Intronic
930696473 2:54416793-54416815 GAATAGACACAGAGGGGACTTGG + Intergenic
931338558 2:61375477-61375499 AAGTAGAAACAGGCGGGGCGCGG + Intronic
934973908 2:98786916-98786938 GACTAGAAACAGCGGCGGCTGGG - Intergenic
935712914 2:105914952-105914974 TAGTAGACACTGCTGGGGCTGGG - Intergenic
936262463 2:110973653-110973675 GAGTGGACACAGCTGGAGGTGGG + Intronic
937268224 2:120630563-120630585 GAGGACACTGAGCCGGGGCTGGG + Intergenic
937763114 2:125629115-125629137 GAGGAAACACAGCCAGTGCTAGG - Intergenic
946716052 2:222556435-222556457 GAGTGGACGGAGCCGGGGTTGGG - Intronic
948251330 2:236532242-236532264 GAGCAGCCACAGCCGGTGCTGGG - Intergenic
948514841 2:238497515-238497537 GAGAAGCCACAGCCCGGGCAGGG + Intergenic
948530218 2:238599419-238599441 GACTAGGCACAGCCAGTGCTGGG + Intergenic
1169305739 20:4488846-4488868 GAGTAGAGGCAGCCTGGGATAGG + Intergenic
1169463693 20:5819150-5819172 AAGTAGACACTGGCGGGGCACGG - Intronic
1170761439 20:19254709-19254731 GAGGACACACAGCATGGGCTGGG + Intronic
1171083320 20:22211046-22211068 GAGTAGTCATAGCAGGGGTTAGG - Intergenic
1172510384 20:35496877-35496899 GACTAGACAAGGCGGGGGCTTGG + Intronic
1173642856 20:44615786-44615808 GAGAAGACTTTGCCGGGGCTTGG + Intronic
1176209712 20:63913167-63913189 GGGAAGACACAGCAGGGGCTGGG - Intronic
1178351107 21:31873549-31873571 GCGGAGACCCAGGCGGGGCTGGG + Exonic
1179127113 21:38600185-38600207 GGGTAGCCAAAGCCGGGGCGGGG - Intronic
1179820820 21:43935853-43935875 GAGAAGCCTCAGCCAGGGCTCGG + Intronic
1181298486 22:21861545-21861567 GAGTTGAGACAGCTGGGGGTAGG - Intronic
1182795261 22:32987092-32987114 GAGTTAACGCAGCCAGGGCTTGG + Intronic
1184899643 22:47437037-47437059 GAGTCCACACAGTCTGGGCTTGG + Intergenic
949901058 3:8815077-8815099 GAGTAGACACAGAAGAGGCGGGG + Intronic
950659453 3:14457881-14457903 GAGTAGAGAGAGCCAAGGCTCGG - Intronic
952191482 3:31027387-31027409 TGGTAGACACAGGCAGGGCTTGG + Intergenic
952874427 3:37931448-37931470 GAGAAGACACAGAGGGGGCTGGG - Intronic
955878662 3:63521090-63521112 GAGCAGACACAGCAGTAGCTGGG - Intronic
956801431 3:72762954-72762976 AAGTAGAAACAGGCCGGGCTTGG - Intronic
961523234 3:127480356-127480378 GAGCAGACTCAGCCTGGTCTGGG + Intergenic
963779046 3:149468864-149468886 GGGTAGACACAGCCTGAGTTAGG - Intergenic
968091289 3:195899948-195899970 GGGGAGGCAAAGCCGGGGCTGGG - Intronic
970537235 4:17042014-17042036 GAAAAGACACAGCCATGGCTGGG + Intergenic
976143176 4:82014483-82014505 GAGAAGACAGAGCTGAGGCTGGG + Intronic
977590131 4:98817072-98817094 GAGTATACAAAGCCATGGCTGGG + Intergenic
983398545 4:167234180-167234202 GAGGAGACACAACGGGGGGTGGG + Intronic
983891910 4:173038308-173038330 GAGGAGCCACAGCAGCGGCTGGG + Intronic
986004388 5:3656114-3656136 GAGGAGACAGAGCAGGGGCCTGG + Intergenic
986013965 5:3741088-3741110 GACCAGACAAAGCCGGGGCATGG + Intergenic
986144987 5:5069644-5069666 GAGTAGACATAGCAAGTGCTGGG + Intergenic
986243191 5:5979995-5980017 GAGTTGACCCAGCTGAGGCTTGG - Intergenic
988482913 5:31644602-31644624 GAGAAGCCACGGCCGGGGGTAGG - Intronic
992805327 5:80331741-80331763 GAGAAGAAACAACCGGGGATAGG - Intergenic
996552742 5:124747274-124747296 GACTAAACACAGGAGGGGCTGGG - Intronic
999090932 5:148935337-148935359 AAGCAGACACAGTCAGGGCTGGG + Intronic
999269245 5:150286775-150286797 GAGTTGGCCCATCCGGGGCTGGG - Intronic
1001092215 5:168749852-168749874 CAGTTCACACAGCCAGGGCTTGG - Intronic
1001301197 5:170535071-170535093 CAGTGGGCACAGCAGGGGCTGGG + Intronic
1002300686 5:178255852-178255874 GAGGAGACAGAGCCGAGGCCAGG + Intronic
1003326233 6:5093414-5093436 GACAAGCCACAGCCTGGGCTTGG - Intergenic
1006394425 6:33777882-33777904 CAGGAGGCACAGCAGGGGCTTGG - Intronic
1006816001 6:36850405-36850427 GCGTAGAGACAGCTGAGGCTAGG + Intergenic
1008466737 6:51839972-51839994 AAGAAGACAGAGCTGGGGCTTGG - Intronic
1010341217 6:74755219-74755241 GAGGAGTCACAGCCCTGGCTTGG - Intergenic
1013503614 6:110776632-110776654 GAGAAGATACAGCTGAGGCTGGG - Intronic
1016003429 6:139066162-139066184 AAGTAAAGACAGCTGGGGCTTGG + Intergenic
1018342231 6:162863068-162863090 GAGTGGAAAAAGCCTGGGCTGGG + Intronic
1019340421 7:506447-506469 GAGTGGACAGAGTCGTGGCTGGG + Intronic
1020084700 7:5303953-5303975 GGGCAGTCACAGCCGGGGCCGGG - Exonic
1020649344 7:10855574-10855596 GAGGAGTCACAGCCATGGCTTGG - Intergenic
1025209604 7:57013247-57013269 GGGCAGTCACAGCCGGGGCCGGG + Intergenic
1025662347 7:63563603-63563625 GGGCAGTCACAGCCGGGGCCGGG - Intergenic
1033274933 7:139964639-139964661 TAGTAGACACAGCAGAGGCTAGG + Intronic
1035913943 8:3598513-3598535 GAGACGTCACAGCCAGGGCTTGG - Intronic
1037609454 8:20464076-20464098 GGGTGGACACAGCAGTGGCTGGG + Intergenic
1047010183 8:120663768-120663790 GAGAAGACAGAGACGGGGCAAGG + Intronic
1048692453 8:136982982-136983004 GAGTAGACAGAGCCTGGGCCTGG + Intergenic
1049250082 8:141583613-141583635 GATTAGACCCACCCGAGGCTCGG - Intergenic
1049803401 8:144528447-144528469 GAGAAGTCAGCGCCGGGGCTGGG + Intronic
1050673954 9:8030590-8030612 GACTAGACACAGCCTTGTCTGGG + Intergenic
1057968620 9:99530531-99530553 GAGAAGACACAGTCTGAGCTGGG - Intergenic
1059631966 9:116134650-116134672 AAATAGAAACAACCGGGGCTAGG - Intergenic
1061077476 9:128350405-128350427 GGGTAGGCACAGGCAGGGCTGGG + Intronic
1061916754 9:133759592-133759614 GAGTTGAGGCAGCCGGGTCTGGG + Intergenic
1062293974 9:135813939-135813961 GAGAAGACAGAGGCGGGGCTAGG - Intronic
1203745736 Un_GL000218v1:39921-39943 GAGCAGGTACAGCCGGGTCTGGG + Intergenic
1186238044 X:7534961-7534983 GGGTAGACACAACATGGGCTGGG - Intergenic
1190320124 X:49175156-49175178 GAGTGGAAACAGCTGGGGCAAGG + Exonic
1200119957 X:153785516-153785538 GTGGAGCCACAGCCGGGCCTAGG - Exonic
1201159060 Y:11154933-11154955 GAGCAGGTACAGCCGGGTCTGGG + Intergenic