ID: 902814276

View in Genome Browser
Species Human (GRCh38)
Location 1:18907355-18907377
Sequence GTCGAGGAGCAGAAAGAGGA TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 955
Summary {0: 1, 1: 0, 2: 0, 3: 98, 4: 856}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902814269_902814276 22 Left 902814269 1:18907310-18907332 CCCCGACTGGCCAGTCGAGGGAA 0: 1
1: 0
2: 0
3: 5
4: 72
Right 902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG 0: 1
1: 0
2: 0
3: 98
4: 856
902814272_902814276 12 Left 902814272 1:18907320-18907342 CCAGTCGAGGGAACTGCTGAGAG 0: 1
1: 0
2: 0
3: 9
4: 125
Right 902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG 0: 1
1: 0
2: 0
3: 98
4: 856
902814271_902814276 20 Left 902814271 1:18907312-18907334 CCGACTGGCCAGTCGAGGGAACT 0: 1
1: 0
2: 0
3: 11
4: 84
Right 902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG 0: 1
1: 0
2: 0
3: 98
4: 856
902814270_902814276 21 Left 902814270 1:18907311-18907333 CCCGACTGGCCAGTCGAGGGAAC 0: 1
1: 0
2: 0
3: 5
4: 80
Right 902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG 0: 1
1: 0
2: 0
3: 98
4: 856

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902814276 Original CRISPR GTCGAGGAGCAGAAAGAGGA TGG Exonic
900540636 1:3200965-3200987 GAAGAGGAGGAGGAAGAGGAGGG + Intronic
900868906 1:5287977-5287999 ACCGAGTAGCAGAAGGAGGAAGG - Intergenic
901195715 1:7438757-7438779 CTGGTGGAGCAGAAAGAGCATGG + Intronic
901897363 1:12325552-12325574 GTAGAGAAGTAGAAAGAGGCCGG - Intronic
902170407 1:14605679-14605701 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
902492238 1:16791742-16791764 GACGAGGAGGAGGAAGAGGAGGG + Intronic
902785432 1:18730061-18730083 GTCGGGGAGGTGAAAAAGGAAGG + Intronic
902814276 1:18907355-18907377 GTCGAGGAGCAGAAAGAGGATGG + Exonic
903183104 1:21614941-21614963 GGCCAGGAGCAGATAGAGGCAGG + Intronic
903348546 1:22703681-22703703 CTTGAGGAGCAGAAAGAGTGTGG - Intergenic
903411898 1:23151509-23151531 ATAGAGGAGCAGAAAGAACATGG + Intronic
904037482 1:27566679-27566701 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
904492081 1:30867482-30867504 TTGGAGGAGTAGAAAGAGCATGG - Intergenic
904801501 1:33096258-33096280 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
904920148 1:34001013-34001035 GGGGAGGAGGAAAAAGAGGAGGG + Intronic
904920155 1:34001037-34001059 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
905174251 1:36126005-36126027 GTCTAGGAGAAGAAGGAGGACGG + Intergenic
905237817 1:36562181-36562203 GAGGAAGAGCAGAAGGAGGAAGG - Intergenic
905322458 1:37127723-37127745 GCCGAGGAGTAGCAAGGGGAAGG + Intergenic
905401795 1:37708965-37708987 GAGGAGGAGGAGGAAGAGGAGGG - Exonic
905468330 1:38172875-38172897 GTCAAGGAGCAGAATTAGGCTGG + Intergenic
905948447 1:41924218-41924240 CACCAGGAGCAGAAAGAGGTAGG + Intronic
906125632 1:43425460-43425482 GTCGAGAAGCTAAAGGAGGAAGG - Exonic
906192113 1:43905280-43905302 GAAGAGGAGCAGAAGGAGGCAGG - Intronic
906192134 1:43905352-43905374 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192145 1:43905391-43905413 GAAGAGGAGCAGAAGGGGGAGGG - Intronic
906192290 1:43905932-43905954 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192313 1:43906003-43906025 GAAGAGGAACAGAAGGAGGAGGG - Intronic
906192433 1:43906438-43906460 GGAGAGGAGCAGGAGGAGGAGGG - Intronic
906192456 1:43906509-43906531 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
906192485 1:43906638-43906660 GAAGAGGAGCAGGAGGAGGAGGG - Intronic
907230084 1:52989452-52989474 GTGGAGCTGCAGAAAGAGGGAGG - Intronic
907474247 1:54695069-54695091 GTCAGGCAGCAGAGAGAGGAAGG - Intronic
907475214 1:54700968-54700990 TTTGAGGAGCAGCAAGAGGTTGG + Intronic
907858389 1:58326453-58326475 CTTGAGGAGGAGAAAGATGAAGG + Intronic
907896425 1:58697147-58697169 GTAGAGGAGTAGAAGGAGGGAGG + Intronic
908293111 1:62687945-62687967 GCCGAGGAGCAGGAGGAGGCGGG + Intronic
908894219 1:68880765-68880787 TTCGAGGAGCTGAAAGAAGACGG - Intergenic
909457371 1:75865514-75865536 GTCGAGAGGCAGAAGGAGCAAGG + Intronic
909514617 1:76492983-76493005 GCCTAGAAGGAGAAAGAGGAAGG + Intronic
909615041 1:77598370-77598392 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
910274803 1:85437429-85437451 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
910457881 1:87417343-87417365 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
910892069 1:92028872-92028894 GCTGAGGAGGAGAAAGAAGAAGG - Intergenic
911104626 1:94119999-94120021 CTAAAGGAGCTGAAAGAGGAAGG - Intronic
911165948 1:94724337-94724359 CACGAGGAGGAGGAAGAGGAAGG - Intergenic
911729678 1:101279828-101279850 CTCGGGGGGCTGAAAGAGGAAGG + Intergenic
911812763 1:102304618-102304640 GCAGAGGAGAAGGAAGAGGAGGG - Intergenic
911886862 1:103312754-103312776 GGCTAGGAGGAGAGAGAGGATGG + Intergenic
912285589 1:108365157-108365179 GAGTGGGAGCAGAAAGAGGAAGG - Intergenic
912664938 1:111570481-111570503 GTGGGGGAGCAGGCAGAGGAGGG + Intronic
912723338 1:112038265-112038287 GGTGATGAGCAGAAAGATGAGGG - Intergenic
912759315 1:112352837-112352859 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
912993435 1:114510928-114510950 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
913223401 1:116677636-116677658 GACGGGCAGCAGAAGGAGGAAGG - Intergenic
913320409 1:117584146-117584168 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
913380085 1:118201161-118201183 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
913446083 1:118952063-118952085 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
913539440 1:119804872-119804894 GGTGAGGGGCAGAAAGGGGAGGG - Intronic
914315148 1:146503820-146503842 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
914499206 1:148229556-148229578 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
914798880 1:150945201-150945223 TACGAGGATAAGAAAGAGGAAGG - Intronic
915268410 1:154734688-154734710 GTCAGGGAGCAGCAAGAGCATGG + Intronic
915480455 1:156181021-156181043 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
915842652 1:159228042-159228064 ATAGAGGAAGAGAAAGAGGAGGG - Intergenic
916688071 1:167165912-167165934 TTCGGGGAGAAGAAAGAGCAAGG - Intergenic
916726861 1:167531432-167531454 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
916943701 1:169702602-169702624 GTGGATGAGCAGAGAGAGGCAGG - Intronic
917390739 1:174533470-174533492 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
917815543 1:178706202-178706224 GTGGAGGAGCAGTAGGAGAATGG + Intergenic
917864854 1:179184579-179184601 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
918033254 1:180838307-180838329 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
918146368 1:181759500-181759522 GTTGAGGAGAAGAAAAAAGAGGG - Intronic
918367544 1:183824552-183824574 TTCTAGGAGCAAAAATAGGAAGG - Intronic
918581201 1:186132136-186132158 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
918953574 1:191174388-191174410 GAGGAGGAGAACAAAGAGGAGGG + Intergenic
918999881 1:191816729-191816751 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
919801765 1:201358682-201358704 GGCTAGGAGGAGAAAGAGAACGG + Intergenic
919846246 1:201644082-201644104 GGGGAGGTGCAGAAAGAGGCTGG - Intronic
919870837 1:201820054-201820076 GAGGAGGAGATGAAAGAGGAGGG + Exonic
920533517 1:206722582-206722604 GAAGAGGAGGAGGAAGAGGAAGG + Intronic
921117913 1:212112079-212112101 GTCCAGGAGCAAGATGAGGATGG - Intergenic
921994974 1:221408478-221408500 GTCTAGGAGCAAATAGAGGCTGG - Intergenic
922960660 1:229643128-229643150 GTTGAGGAGGAGGAAGAGGAGGG + Intronic
923152750 1:231248376-231248398 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
923432469 1:233936571-233936593 GAAGAGGAGGAGGAAGAGGAAGG - Intronic
923474827 1:234322532-234322554 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
923498983 1:234549150-234549172 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
923528209 1:234790795-234790817 GACGAGGAGGAGGAAGAGGAGGG - Intergenic
923754407 1:236777558-236777580 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
923920679 1:238561133-238561155 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
924196481 1:241612863-241612885 GACCATGAGGAGAAAGAGGATGG - Intronic
924202635 1:241675271-241675293 GGGGAGGAGGAGAGAGAGGAAGG - Intronic
924389634 1:243539211-243539233 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
924703178 1:246474852-246474874 GTCAAGTAGCAGGAAGGGGAAGG + Intronic
924735283 1:246750095-246750117 TTCGAACAGCAGAAAGAGGATGG - Intronic
1063017777 10:2095704-2095726 GTGGAGGGACAGAGAGAGGATGG + Intergenic
1063260166 10:4378860-4378882 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1063500931 10:6553610-6553632 GTGGAGGAGAAGGAGGAGGAAGG - Intronic
1064407683 10:15079098-15079120 CTCAAAGAGCAGGAAGAGGAAGG + Intronic
1065182362 10:23139394-23139416 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1065397791 10:25259088-25259110 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1065446302 10:25805113-25805135 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1065515062 10:26516575-26516597 GTCAAGGAGGGGAAAGAGGGAGG + Intronic
1065517979 10:26543920-26543942 GGCGAGGAGCAGAATCAGGCAGG - Intronic
1066011574 10:31199145-31199167 GAGAAGGAGGAGAAAGAGGAAGG - Intergenic
1066074081 10:31855000-31855022 GAGGAGGAGCAGGAGGAGGATGG + Intronic
1066237118 10:33496246-33496268 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1067542900 10:47169044-47169066 GTTGAGGAGAAGGAAGGGGAAGG - Intergenic
1067799600 10:49349923-49349945 GAGGTGGAGCAGAAAGAGGAAGG + Intergenic
1068435743 10:56989043-56989065 GGGGAGGAGGAGGAAGAGGAGGG + Intergenic
1069340048 10:67399087-67399109 GAGGAGGAGGAGAAAGAGAAAGG + Intronic
1069615098 10:69801839-69801861 GACGAGGAGGAGGAGGAGGAGGG + Intergenic
1069668746 10:70183624-70183646 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1069960183 10:72074932-72074954 GCCCAGGAGCAGACAGAGGAAGG + Intronic
1070313072 10:75287702-75287724 ATGGAGCAGCAGAATGAGGAGGG - Intergenic
1070326106 10:75390333-75390355 GTGAAGGAGGAGGAAGAGGAGGG - Intergenic
1071014052 10:80973716-80973738 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1071663003 10:87524736-87524758 CTGGAGGAGAGGAAAGAGGATGG + Intronic
1071805054 10:89109613-89109635 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1072228634 10:93393786-93393808 GATGAGAAGCAGAAGGAGGAAGG - Intronic
1072686983 10:97543301-97543323 GCCGAGGAGGAGGAAGAGGAAGG + Intronic
1073522156 10:104142753-104142775 GTCAAGAAGCAACAAGAGGAAGG + Intronic
1074204451 10:111270736-111270758 GAAGAGGAGGAGAAAAAGGAAGG - Intergenic
1074438294 10:113453168-113453190 TTCGGGTAGTAGAAAGAGGAAGG + Intergenic
1074506036 10:114071671-114071693 GCCGAGGAGCTTAGAGAGGATGG + Intergenic
1075106408 10:119542720-119542742 GGCGAGGAGGAGGAGGAGGAGGG + Intergenic
1075349801 10:121713583-121713605 GTGGTGGCGCAGAAAGATGATGG - Intergenic
1075443312 10:122496096-122496118 CTCGAGGAGCTGAAAGTGGCTGG + Intronic
1075686133 10:124366612-124366634 TTCAAGGAGCAGGGAGAGGAAGG + Intergenic
1076064435 10:127438188-127438210 TTCTAGGACCAGAAACAGGATGG + Intronic
1076098924 10:127758193-127758215 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1076161050 10:128244538-128244560 GCAGTGGAGGAGAAAGAGGAGGG - Intergenic
1077048166 11:555248-555270 GGAGAGGAGGAGAACGAGGAGGG + Intronic
1077329613 11:1978277-1978299 CTTGAGGTGCAGAGAGAGGATGG + Intronic
1077477826 11:2798897-2798919 CTGGAGGAGCAGGAACAGGACGG + Intronic
1078313474 11:10270491-10270513 GCTGAGGAGGAGGAAGAGGAAGG + Intronic
1078434402 11:11312515-11312537 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1079120435 11:17680298-17680320 TTCAAGGGGAAGAAAGAGGAAGG - Intergenic
1079885021 11:25976731-25976753 GAGGAGAAGCAGAAAGAGAAGGG + Intergenic
1080106109 11:28512961-28512983 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1081129875 11:39365796-39365818 GTTGATGAGAAGATAGAGGAGGG + Intergenic
1081906346 11:46672758-46672780 GTGGAGTCGCAGAAAGAGGAAGG + Intronic
1082176283 11:49063802-49063824 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1082251762 11:49990170-49990192 TCTGAGGAGCAGAAAGAGAAAGG - Intergenic
1082859623 11:57842326-57842348 GTCAAGGAGCAGAGTGAGGGAGG + Intergenic
1083079874 11:60080177-60080199 ATAGAGGAAGAGAAAGAGGAAGG - Intergenic
1083421552 11:62556166-62556188 GGTGAGGAGCAGAAAGGGAAGGG - Intronic
1083944869 11:65918183-65918205 GGTGAGGAGCTGGAAGAGGAGGG - Exonic
1084049942 11:66593035-66593057 GTCCAGGAACAGAAAGCCGAGGG + Exonic
1084155352 11:67310079-67310101 GTCTGGGAGCAGAAAGTGGGTGG + Exonic
1084495974 11:69503695-69503717 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1085199659 11:74694117-74694139 CTGGAGGAGGAGATAGAGGAGGG - Intergenic
1085582536 11:77667365-77667387 GAGGAGGAGGAGGAAGAGGAAGG - Exonic
1085816064 11:79738796-79738818 GTGGAGGAAGAGAAGGAGGATGG + Intergenic
1086078880 11:82882122-82882144 CAGGAGGAGGAGAAAGAGGAGGG + Intronic
1086246856 11:84763292-84763314 GTCAAGGAATAGAAAGAGGCAGG - Intronic
1086428746 11:86714863-86714885 GGCATGGAGAAGAAAGAGGATGG + Intergenic
1086520501 11:87663297-87663319 GACAGAGAGCAGAAAGAGGAAGG + Intergenic
1086689435 11:89772064-89772086 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
1086716422 11:90067890-90067912 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1086722514 11:90138277-90138299 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1086825525 11:91490363-91490385 AGGAAGGAGCAGAAAGAGGAAGG - Intergenic
1086987516 11:93266534-93266556 TTAGAACAGCAGAAAGAGGATGG + Intergenic
1086998900 11:93392926-93392948 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1086998907 11:93392948-93392970 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
1087058144 11:93953264-93953286 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1087496498 11:98896946-98896968 GGAGAGGAGGAGACAGAGGAGGG + Intergenic
1088373910 11:109119826-109119848 GATGAGGGGCAGAAAGAGGCCGG - Intergenic
1089072153 11:115709158-115709180 GGCGAGGTGGAGAAAGAGGCTGG + Intergenic
1089097024 11:115927690-115927712 TTCGAGAAGCTGAAAGAAGATGG + Intergenic
1089132392 11:116222912-116222934 GTCATGGATCAGAAAGAGCAAGG - Intergenic
1089356639 11:117858241-117858263 GACGGGAAGCAGAAAAAGGAGGG - Intronic
1089546990 11:119235524-119235546 GAGGAGGAGTAGGAAGAGGAGGG + Intronic
1090069815 11:123534321-123534343 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1090269615 11:125376962-125376984 ATAGAGGCCCAGAAAGAGGAGGG - Intronic
1090854938 11:130602917-130602939 GTGGAGGAGCAGTGAGGGGAGGG + Intergenic
1091078918 11:132647680-132647702 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1091263374 11:134251781-134251803 TTCAAGGAGCAGAAAGGAGATGG - Intronic
1202812592 11_KI270721v1_random:33456-33478 CTTGAGGTGCAGAGAGAGGATGG + Intergenic
1091544311 12:1490896-1490918 GCCGAGGAACAGAGTGAGGAAGG - Exonic
1091696454 12:2631263-2631285 GAGGAGGAGGAGAGAGAGGAAGG - Intronic
1091842053 12:3628332-3628354 GTGGAGGAGGAGGAAGAAGAAGG + Intronic
1092021297 12:5204550-5204572 GCCGAGGAGCAGAGAAAGAATGG + Intergenic
1092139259 12:6171613-6171635 GTTGAGGAGGAGGAGGAGGAAGG + Intergenic
1092210670 12:6644392-6644414 GAAGAGGAACAGGAAGAGGAGGG - Exonic
1092252178 12:6905697-6905719 GACGAGAAGGAGACAGAGGAGGG + Exonic
1092428435 12:8391352-8391374 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1092429516 12:8397504-8397526 GGAAAGAAGCAGAAAGAGGACGG + Intergenic
1093144599 12:15550358-15550380 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1094698214 12:32842600-32842622 GAAGAGGGGCAGAAAGAGAAGGG + Intronic
1095304496 12:40623899-40623921 GTGGTGGAGCAGAGAGAGTAAGG + Intergenic
1096036197 12:48473280-48473302 GACGAGGAGGAGAAGGATGAAGG + Exonic
1096383379 12:51177851-51177873 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1096710505 12:53452221-53452243 GTGGAGGAGGAGGAGGAGGAAGG - Exonic
1096777756 12:53974323-53974345 GTGGAGGGGGAGAAAGGGGAGGG + Intronic
1097564258 12:61248717-61248739 GTGGAGGAGAAGGAAGAGGAGGG - Intergenic
1098061041 12:66563001-66563023 GCTGAGGAGAAGGAAGAGGAGGG + Intronic
1098284269 12:68892334-68892356 GTCGAGGGGCACAATGAGGATGG + Intronic
1098582306 12:72114571-72114593 GTGGAGGAGAAGGAAGAAGAGGG + Intronic
1098603188 12:72358288-72358310 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1098622072 12:72613758-72613780 GAGAAGGAGCAGAAGGAGGAGGG + Intronic
1099146393 12:79050306-79050328 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1099491056 12:83288548-83288570 GCTGAAGAGAAGAAAGAGGAGGG - Intergenic
1099643391 12:85319524-85319546 GAGGAGGAGGACAAAGAGGAGGG - Intergenic
1099811500 12:87588067-87588089 GAAGAGGAGGAGAAAAAGGAAGG + Intergenic
1099999391 12:89814747-89814769 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1100003139 12:89861366-89861388 GAAGAGGAGGAGAAAGAGGAGGG + Intergenic
1100728534 12:97437114-97437136 GGTGAGGAGCAGAGACAGGAGGG - Intergenic
1100766744 12:97874600-97874622 GCTGAGGAGGAGAAAGAGGAAGG - Intergenic
1101001013 12:100357183-100357205 GGTGGGGAGCAGAGAGAGGAGGG + Exonic
1101195781 12:102380702-102380724 GTGGATGTGGAGAAAGAGGATGG + Intergenic
1101836204 12:108297155-108297177 GCTGAGGAACAGGAAGAGGAGGG - Intronic
1102596945 12:114000137-114000159 GTTGGGAAGCAGAAACAGGAGGG - Intergenic
1102990606 12:117313125-117313147 GCCGAGGAGGAGGAAGAAGATGG - Intronic
1103044840 12:117727459-117727481 GAAGAGGAGGAGAAAGAAGAAGG + Intronic
1103056040 12:117821336-117821358 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
1103163230 12:118748459-118748481 GAGGAGGAGAAGAAAGAGGAGGG + Intergenic
1103205643 12:119126666-119126688 GTTGATGAGAAGAAGGAGGAAGG + Intronic
1103235374 12:119368171-119368193 GGGGAGGAGGAGAAAAAGGAGGG + Intronic
1104506747 12:129339315-129339337 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
1104675743 12:130710825-130710847 GTGGAGGAGCAGGTAGAGCAGGG - Intronic
1105205669 13:18221508-18221530 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1105283187 13:18981777-18981799 GCCAGGGAGCAGAAGGAGGATGG + Intergenic
1106189746 13:27441080-27441102 GAGGAGGAGGAGCAAGAGGAGGG + Intronic
1106215161 13:27690632-27690654 TTCCAGGAGTAGAAAGAGGGTGG - Intergenic
1106220020 13:27738685-27738707 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1106243061 13:27925387-27925409 GAGGAGGAGGAGAAAGAGGAGGG - Exonic
1106243105 13:27925544-27925566 GAGGAGGAGGAGGAAGAGGACGG - Exonic
1106358477 13:29007614-29007636 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1106408753 13:29496550-29496572 GTGGAGGAGGAGATAGGGGAAGG + Intronic
1106555085 13:30802659-30802681 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1106825670 13:33517944-33517966 GTAGAGGAGGAGAAAGAGTGTGG - Intergenic
1106979919 13:35267107-35267129 GTGGAGGAGAAGAAAGAAGAGGG + Intronic
1106985779 13:35347666-35347688 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1107148555 13:37086200-37086222 GGTGAGAAGGAGAAAGAGGAGGG + Intergenic
1107829572 13:44362422-44362444 GTTCAGGAGGAGGAAGAGGAAGG - Intergenic
1107866988 13:44712795-44712817 GTAGAGGAGGAGGAAGAAGAGGG - Intergenic
1108828043 13:54440201-54440223 GAAGAGGAGGAGAAAGAGGGAGG - Intergenic
1108961065 13:56230302-56230324 GTTGAGGAGGACAAAGAAGAGGG + Intergenic
1109252588 13:60037609-60037631 GTTAAGGAGAATAAAGAGGAAGG + Intronic
1109279352 13:60338289-60338311 GAGGAGGAGGAGGAAGAGGATGG - Intergenic
1109757119 13:66775529-66775551 GAGGAGGAGAAGAAAGAGGAGGG - Intronic
1110345166 13:74438597-74438619 TCTGAGGAGCAGAAAGGGGAGGG - Intergenic
1110590114 13:77246602-77246624 GAGGAGGAGAAGAAAGAAGAAGG + Intronic
1110945574 13:81411406-81411428 GAGGAGGAGGAGAAAGAAGAAGG - Intergenic
1112284645 13:98093554-98093576 GCAGAGGAGCAGAAAGAAGGAGG - Intergenic
1113696720 13:112351714-112351736 GTGGAGGGGCAGAAAGAAGAGGG - Intergenic
1114083148 14:19218859-19218881 GTCTTGGAGGAGACAGAGGAGGG - Intergenic
1114262365 14:21046933-21046955 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1114364242 14:22010019-22010041 GATGAGGAGGAGAAGGAGGAAGG + Intergenic
1115401558 14:32967141-32967163 GAGGAGGAAGAGAAAGAGGAGGG - Intronic
1115815567 14:37160957-37160979 GAGGAGGAGGAGAAAGAGGAAGG + Intronic
1116023795 14:39491937-39491959 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1116239920 14:42327425-42327447 GTTGAGGAGAAGAAAGAGATGGG - Intergenic
1116255843 14:42554258-42554280 GAGGAGAAGAAGAAAGAGGAAGG + Intergenic
1116726036 14:48562390-48562412 TTCAAACAGCAGAAAGAGGATGG + Intergenic
1116899450 14:50347839-50347861 ACAGAGGAGCAGAAAGAGGAAGG + Intronic
1117069335 14:52042529-52042551 GTAGTGGAGTAGAAGGAGGAGGG - Intronic
1117309668 14:54509418-54509440 GTGGAGGAGGAGGAGGAGGAGGG - Intergenic
1117480505 14:56139234-56139256 GTGGAGGAGGAGGGAGAGGATGG + Intronic
1117540898 14:56745694-56745716 GTCCAGGAGGAGAAAGAGCCGGG - Intergenic
1117581048 14:57152086-57152108 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
1118168955 14:63366374-63366396 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1118459571 14:65976093-65976115 GAAGAGGAGGAGAAGGAGGAAGG + Intronic
1118916129 14:70107964-70107986 GTCCAAGAGAAGAAAGATGAAGG - Intronic
1118922973 14:70166933-70166955 GAGGAGGAGCAGCCAGAGGAGGG - Exonic
1119067367 14:71542508-71542530 GAGGAGGAGGAGGAAGAGGAAGG - Intronic
1119328273 14:73775154-73775176 GTCCAGGAGCAGCAAGAGGCCGG + Intronic
1119883964 14:78124705-78124727 GTAGAGGAAGAAAAAGAGGAAGG - Intergenic
1119967819 14:78936518-78936540 CTAGAGGAGCAGGGAGAGGAAGG + Intronic
1120067712 14:80063386-80063408 GGAGAAGAGAAGAAAGAGGAAGG - Intergenic
1120161359 14:81148725-81148747 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1120262834 14:82209261-82209283 GAGGAGGAGGAGAAAGAGGTGGG + Intergenic
1120880811 14:89413979-89414001 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1120899897 14:89566826-89566848 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1121006379 14:90493207-90493229 GAGGAGGAGGAAAAAGAGGAGGG - Intergenic
1121488159 14:94336347-94336369 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1121576652 14:94994381-94994403 GTACAGCAGGAGAAAGAGGAAGG - Intergenic
1121641566 14:95487909-95487931 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1121662702 14:95647234-95647256 GTGGAGGAGTAGAAGGAGGAGGG + Intergenic
1121978124 14:98425094-98425116 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1122286469 14:100655403-100655425 GTCGCTGAGCAGTCAGAGGATGG - Intergenic
1122322220 14:100861970-100861992 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1122382764 14:101321387-101321409 TTCGAACAGCAGAGAGAGGATGG + Intergenic
1122927714 14:104915231-104915253 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1202871950 14_GL000225v1_random:173003-173025 GGGGGGGAGCAGAAAGAGGCTGG + Intergenic
1124355647 15:28993020-28993042 CTGGAGGGGCAGGAAGAGGATGG + Intronic
1124403487 15:29372211-29372233 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1124406782 15:29399913-29399935 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1124465111 15:29931249-29931271 GCAGAGGAGGAGGAAGAGGAGGG + Intronic
1124833044 15:33167871-33167893 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1125086393 15:35735118-35735140 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
1125502732 15:40249636-40249658 GTCATGGAGCAGAAAGATGCAGG + Intronic
1126817589 15:52469480-52469502 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1126915111 15:53457716-53457738 GCTGAGGAGGTGAAAGAGGAAGG + Intergenic
1127157089 15:56139600-56139622 TTTGAGGAGCAGAGAGAAGAAGG - Intronic
1127265452 15:57357210-57357232 GCTGAGGAGGAGAAAGAAGAGGG - Intergenic
1127400661 15:58582186-58582208 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1127931555 15:63600502-63600524 GTGCAGGGGCAGAAAGAGGAGGG + Intronic
1128130257 15:65222544-65222566 GTGAAGTAGCAGAAAGATGAAGG - Intergenic
1128869821 15:71145864-71145886 GAGGAGGAGCAGGAGGAGGAGGG + Intronic
1129131572 15:73502612-73502634 GAGGAGGAGGAGTAAGAGGAGGG + Intronic
1129191818 15:73941913-73941935 GTGGAGGGGCAGGAACAGGACGG + Intronic
1129831927 15:78676284-78676306 GTGGAGGAAGAGAAACAGGAGGG + Intronic
1129957287 15:79650572-79650594 GTCGAGGATCACAAATAGGTGGG - Intergenic
1130306265 15:82713995-82714017 GTTGAGGCCCAGAGAGAGGAAGG - Intergenic
1130875381 15:88009344-88009366 GTAGATGAGCAGAAAGAGTTGGG + Intronic
1130927487 15:88396441-88396463 GAGGAGGAGCAGGAAAAGGAAGG - Intergenic
1131014147 15:89043493-89043515 GGGGAGGAAAAGAAAGAGGAAGG + Intergenic
1131014203 15:89043697-89043719 GGAGAGGAGGAGGAAGAGGAGGG + Intergenic
1131135514 15:89931906-89931928 GCCGAGGAGGAGGAAGAGGAGGG + Intergenic
1131339528 15:91584158-91584180 GAGGAGGAGAAGGAAGAGGAGGG - Intergenic
1131442169 15:92467397-92467419 GCCGAGGGGCATCAAGAGGAAGG - Exonic
1131898864 15:97065905-97065927 GACGAGGAGGAGGAAGAGAATGG + Intergenic
1132724971 16:1334471-1334493 GTCGGTGAGCAGAGGGAGGAGGG + Intronic
1132814120 16:1817820-1817842 GCCGCGAAGCAGCAAGAGGAGGG - Intronic
1133194424 16:4158832-4158854 AAGGAGGAGAAGAAAGAGGAAGG + Intergenic
1133389944 16:5402142-5402164 GACCAGGAGCGGGAAGAGGAGGG + Intergenic
1133460662 16:5983888-5983910 GAGGAGGAGGAGAACGAGGAGGG - Intergenic
1133500605 16:6362851-6362873 GTCGAGGTGTAAACAGAGGATGG + Intronic
1133712471 16:8414597-8414619 GAAGAGGAGCAGACAGAGAAGGG - Intergenic
1133774402 16:8885966-8885988 GCCCAGGAGAAGAGAGAGGAGGG - Intergenic
1133802041 16:9092045-9092067 ATGGAGGAGCGGAAGGAGGAGGG + Exonic
1133922574 16:10166803-10166825 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1135295730 16:21278009-21278031 AAGGAGGAGCAGGAAGAGGAGGG - Intronic
1135634042 16:24058959-24058981 GTAGAGGATCAGGGAGAGGATGG + Intronic
1135682555 16:24470556-24470578 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1136013973 16:27383250-27383272 GTAGAGGCTCAGAGAGAGGAAGG + Intergenic
1136458241 16:30394663-30394685 TCCGAGGAGCAGTAAGAGGCTGG - Intronic
1136774258 16:32863210-32863232 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1136896353 16:33998304-33998326 ATCGGGGAGCAGAAGGAAGAGGG - Intergenic
1136922743 16:34345618-34345640 TTCAAGAAGCAGCAAGAGGAAGG + Intergenic
1136981830 16:35066188-35066210 TTCAAGAAGCAGCAAGAGGAAGG - Intergenic
1137776419 16:51058421-51058443 ATCCAGGAGCAGAATGGGGAGGG + Intergenic
1138126174 16:54440503-54440525 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
1138395180 16:56698497-56698519 GTCACAGAGCAGAAAGAGAAGGG + Intronic
1138890450 16:61137691-61137713 GCTGAGGAGTAGGAAGAGGAGGG - Intergenic
1139597476 16:67966808-67966830 TAAGAGGAGGAGAAAGAGGAAGG + Intronic
1139830084 16:69790440-69790462 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
1140903546 16:79391914-79391936 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1141007136 16:80363136-80363158 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1141353582 16:83322142-83322164 GGTCAGGAGCACAAAGAGGAGGG + Intronic
1141393203 16:83681596-83681618 GTGGAGGGGAAGAAAGAGAAAGG - Intronic
1141737823 16:85866653-85866675 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1141891752 16:86930858-86930880 GAAGAGGAGGAGAAGGAGGAGGG - Intergenic
1203076682 16_KI270728v1_random:1125329-1125351 ATCGGGGAGCAGAAGGAAGAGGG + Intergenic
1142489376 17:268206-268228 GATGAGGAGGAGGAAGAGGAGGG - Intronic
1142762296 17:2049852-2049874 GACGCGGAGCAGAAGGAGGCGGG - Intergenic
1143065083 17:4240823-4240845 GTAGAGGAGCAGTGAGAGGTGGG - Intronic
1143281052 17:5754359-5754381 GGCGAATAGCAGAAAGGGGAAGG - Intergenic
1143391407 17:6561209-6561231 GGAGAGGAGGAGGAAGAGGAGGG - Intergenic
1143391583 17:6561840-6561862 GTGGAGGAAGAGGAAGAGGATGG - Intergenic
1143409967 17:6702886-6702908 GCAGAGGAGCAGAGAGAGGTGGG + Intronic
1143698521 17:8639118-8639140 GGCCATGAGAAGAAAGAGGAAGG - Intergenic
1144143219 17:12370491-12370513 GTGGAGAAGCAGAGAGAGGAAGG + Intergenic
1144229351 17:13184785-13184807 GAGGAGGGGGAGAAAGAGGAGGG + Intergenic
1144409297 17:14985002-14985024 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1144580459 17:16456149-16456171 GGAGAGGAGGAGGAAGAGGAGGG + Intronic
1144734530 17:17547646-17547668 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1146339697 17:32007958-32007980 GAGGAGGAGGAGTAAGAGGAGGG + Intronic
1146465695 17:33084458-33084480 GTGGCAGAGCAGAAAGAGCATGG + Intronic
1146534314 17:33637010-33637032 GGGGAGGAGAAGAAGGAGGAAGG - Intronic
1146579372 17:34023236-34023258 GAAGAGGAGAAGAAAGAGAAAGG - Intronic
1146666059 17:34704490-34704512 GTCCAGGAGTAGAAAGAAAATGG - Intergenic
1146915607 17:36676444-36676466 GTAGAGGAGGAGGAGGAGGAGGG + Intergenic
1147134208 17:38425846-38425868 GTCAAGGTGCAGGAAGAGGTGGG + Intergenic
1147524433 17:41207361-41207383 GAAGAGGAGGAGGAAGAGGAGGG + Intronic
1147727185 17:42573310-42573332 GTGGAGGAAGAGGAAGAGGATGG - Exonic
1148382029 17:47206898-47206920 GTGGAGGTGGAGAAGGAGGAGGG + Intronic
1148573060 17:48685968-48685990 GTGGAGGAGGAGGAAGAGGATGG + Intergenic
1148804299 17:50256581-50256603 GAAGAGGAGGAGAAAGAAGAAGG + Intergenic
1149020235 17:51955195-51955217 TTCGAGATGCAGAAAGATGAAGG - Intronic
1149039325 17:52169226-52169248 GGCCAGGAGCAGAAAGAGAAGGG - Intergenic
1150278042 17:63912149-63912171 GAGGAGGAGAAAAAAGAGGACGG - Intronic
1150279357 17:63920034-63920056 GAGGAGGAGAAAAAAGAGGAGGG - Intergenic
1150666003 17:67139010-67139032 GTCCAGGGGCATACAGAGGAAGG + Intronic
1151157203 17:72133579-72133601 GGGGAGGAGAAGAAAGAGAAAGG + Intergenic
1151542644 17:74772547-74772569 ATGAAGGAGCAGAAACAGGAGGG + Intronic
1152303480 17:79508493-79508515 TGCGGGGAGCAGAGAGAGGAGGG - Intronic
1152375296 17:79915724-79915746 GTCGAGGGGCAGGTGGAGGAGGG + Intergenic
1152745288 17:82036020-82036042 GTCACTCAGCAGAAAGAGGATGG + Exonic
1152774416 17:82191570-82191592 GTTGAGGAGGAGGCAGAGGATGG - Intronic
1153417215 18:4859942-4859964 GTCATGGTGCAGAAAGTGGAGGG + Intergenic
1153794092 18:8607078-8607100 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1153919878 18:9779033-9779055 GAGGAGGAGCAGGAAGAGGAGGG + Intronic
1153923792 18:9815143-9815165 GTCAAGGAGCTGAAAGAACATGG + Exonic
1155015838 18:21838408-21838430 GTGGATGAGAAGAAAGATGATGG + Exonic
1155507598 18:26548295-26548317 GACGAGGAGGAGGAGGAGGACGG - Intronic
1155545433 18:26909781-26909803 GAGGAGGAGGAGGAAGAGGAGGG + Exonic
1156019544 18:32583953-32583975 GGGGAGGAGCAGAAAGAGACAGG + Intergenic
1156100372 18:33586644-33586666 GGCGACGAGAATAAAGAGGAGGG - Intronic
1156625582 18:38903663-38903685 GCTGAGGAGCAGGCAGAGGATGG - Intergenic
1157084995 18:44570992-44571014 GTGGAGGAGGGGAGAGAGGAAGG + Intergenic
1157127813 18:44973788-44973810 GTGGAGAGGCAGACAGAGGAGGG + Intronic
1157276069 18:46311896-46311918 GAGGAGGAGGAGAAGGAGGAAGG + Intergenic
1157382031 18:47227207-47227229 GTGGAGGAGGAGGAGGAGGAAGG - Intronic
1157445520 18:47743760-47743782 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
1157470287 18:47983173-47983195 GGGGAGGAGAAGAAGGAGGAAGG - Intergenic
1157800684 18:50618235-50618257 GTCGATGAGCAGATAGGTGAGGG - Intronic
1157911738 18:51623028-51623050 GTCCAGGAACAGAAAGGGGCAGG + Intergenic
1159848281 18:73493294-73493316 GAGGAGGAGAAGGAAGAGGACGG - Intergenic
1159934283 18:74349986-74350008 GTATAGGAGCACAAGGAGGAGGG + Intronic
1160077660 18:75693513-75693535 GGGGAGGAGCAGACAGAGGGAGG + Intergenic
1160242899 18:77135913-77135935 GTGGAGGGAGAGAAAGAGGAAGG + Intergenic
1160527102 18:79544483-79544505 GGTGAGGAGCAGAGAGGGGAAGG - Intergenic
1160866253 19:1257509-1257531 GAGGAGGAGGAGGAAGAGGAGGG - Exonic
1161607355 19:5222446-5222468 GTGGAGGAGGAGGAAGAGGGGGG + Intronic
1161803532 19:6429462-6429484 GAGGAGGAGAGGAAAGAGGAGGG + Intronic
1162579968 19:11523155-11523177 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1162722714 19:12672065-12672087 GCAGAGGAGGAGGAAGAGGAGGG + Intronic
1162888301 19:13712944-13712966 TTTGAGAAGCTGAAAGAGGAGGG + Intergenic
1163163912 19:15482321-15482343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1163445879 19:17346253-17346275 GGAAAGGAGGAGAAAGAGGAGGG + Intergenic
1163518423 19:17778638-17778660 GACGAGGAGGAGAAAGGGGAGGG - Exonic
1163611526 19:18304383-18304405 GAGGAGGAGGAGAGAGAGGAGGG + Intergenic
1163749543 19:19067741-19067763 GTCTAGGAAAAGAAAGATGAGGG + Intronic
1163759839 19:19130208-19130230 GGCCAGCAGCAGGAAGAGGAAGG + Exonic
1164921892 19:32094470-32094492 GAAGAGGAAGAGAAAGAGGAAGG + Intergenic
1165069753 19:33248494-33248516 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1165300016 19:34962941-34962963 GTGGAGGGTGAGAAAGAGGAGGG - Intronic
1165942625 19:39422834-39422856 GAGGAGGAGGAGGAAGAGGAAGG + Exonic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166672452 19:44719035-44719057 GAAGAGGAGAAGAAAGAGGAAGG + Intergenic
1166913628 19:46179058-46179080 GGAGAGGAGGAGAAAGAGGCAGG + Intergenic
1167106430 19:47432421-47432443 GACGAGGAGGAGGAGGAGGACGG - Exonic
1167194115 19:48015240-48015262 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
1167395200 19:49223870-49223892 GTGGAAGAGCAGAAAGAGAGGGG + Intergenic
1167409487 19:49336663-49336685 GAGGAGGAGCTGAAGGAGGAAGG + Intronic
1167517698 19:49932801-49932823 GTTGAGGTGGAGAAGGAGGAGGG - Exonic
1167520442 19:49951570-49951592 GTTGAGGAGGAGAGATAGGAGGG + Intronic
1167608575 19:50494906-50494928 GTGGAGGAGCAGAGGGAGGAGGG + Intergenic
1167685734 19:50954881-50954903 GCCGTGGAGCACAAAGAGGCAGG + Intergenic
1168288660 19:55346718-55346740 GACCAGGAGCAGACAGGGGAGGG - Intronic
1168590762 19:57632832-57632854 GTCGGGGAGCTGGAAGAGGCAGG + Intronic
925077199 2:1026819-1026841 GGCAAAGAGCAGGAAGAGGAAGG - Intronic
925249188 2:2416383-2416405 GAGGAGGAGGAGTAAGAGGATGG + Intergenic
925651427 2:6093687-6093709 GAAGAGGAGAAGAAAGAGGTTGG + Intergenic
925842588 2:8006566-8006588 ATGGAGGAGAAGAGAGAGGAGGG - Intergenic
926401482 2:12501606-12501628 GTGGAGGGGCAGGAAGGGGAAGG - Intergenic
926573277 2:14553199-14553221 GTAGAGGATGAGAAAGAGGTGGG - Intergenic
926753639 2:16219281-16219303 GGGGAGGAACAGAAGGAGGAGGG - Intergenic
927370934 2:22354539-22354561 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
927612661 2:24557491-24557513 GAGGAGGAGCAGGAGGAGGAGGG - Intronic
927649376 2:24902647-24902669 GAGGAGGAGGAGAAAGAGAAGGG - Intronic
927803572 2:26123961-26123983 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
927869658 2:26615503-26615525 GTTGAGGCCCAGGAAGAGGAAGG + Intronic
928416721 2:31098947-31098969 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
928822701 2:35381212-35381234 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
929161422 2:38836321-38836343 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
929444564 2:41992108-41992130 GTGGAGGAGAGGAGAGAGGAAGG + Intergenic
929787843 2:45004893-45004915 CTCGAGGTGGAGAAAGAGGCTGG + Intergenic
930571092 2:53088153-53088175 GTGGAGGAGAAGTAAGGGGAGGG + Intergenic
930700743 2:54456465-54456487 GCCGAGGAGCGGGAGGAGGACGG + Exonic
930945703 2:57072322-57072344 ATTGAGGAGAAGGAAGAGGAGGG - Intergenic
931162610 2:59709840-59709862 GAGGAGGAGGAGAAAGAGAAAGG - Intergenic
931903659 2:66819925-66819947 GCGGAGGAGGAGGAAGAGGAGGG + Intergenic
932921847 2:75924956-75924978 GAGGAAGAGGAGAAAGAGGAAGG + Intergenic
933018274 2:77159645-77159667 GAGGAGGAGGAGAAATAGGAGGG + Intronic
933196043 2:79391270-79391292 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
934586167 2:95498051-95498073 GAGAAGGAGGAGAAAGAGGAGGG - Intergenic
934652373 2:96099888-96099910 GGGGAGGAGGAGAAAGGGGAGGG + Intergenic
934652389 2:96099942-96099964 GGTGAGAAGGAGAAAGAGGAAGG + Intergenic
934765528 2:96878162-96878184 GTTGAGGAGGAAAAGGAGGATGG + Intronic
935793736 2:106618892-106618914 GTCAGGAAGCAGAAAGAGGGAGG + Intergenic
935958686 2:108402708-108402730 TTCGAACAGCAGAAAGAGGATGG + Intergenic
936044035 2:109172377-109172399 CTCCAGGAGCAGGGAGAGGACGG - Intronic
936496544 2:113027207-113027229 ACTGAGGAGAAGAAAGAGGAGGG + Intronic
936666716 2:114605347-114605369 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
936832824 2:116669801-116669823 GAAGAGGAGGAGAAGGAGGAAGG - Intergenic
937141056 2:119600818-119600840 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
937142848 2:119617006-119617028 GTCCAGGATCAGAAAGTGCAAGG - Intronic
937320343 2:120957002-120957024 GTGAAGGAGCAGCCAGAGGAGGG - Intronic
937582987 2:123512037-123512059 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
937920040 2:127122402-127122424 AGGGAGGAGCAGAAATAGGAGGG - Intergenic
939018676 2:136932701-136932723 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
939853363 2:147326637-147326659 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
940017975 2:149126570-149126592 GAGGAGGAAAAGAAAGAGGAGGG + Intronic
940401783 2:153256451-153256473 GTTGAGGAGCTGAGAGAAGAAGG - Intergenic
940409357 2:153342678-153342700 GAAGAGGAGCAGGAAGAGGAGGG - Intergenic
941144342 2:161824930-161824952 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
941160530 2:162029683-162029705 ATCCAGGAGCAGAGAGAGCAGGG + Intronic
941442685 2:165557579-165557601 GTGCTGGAGGAGAAAGAGGAGGG + Intronic
941684768 2:168437120-168437142 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
942009323 2:171743290-171743312 GAGGAGGAAAAGAAAGAGGAAGG + Intronic
942232564 2:173873825-173873847 GAAGAGGAGAAGGAAGAGGAGGG + Intergenic
942350780 2:175050699-175050721 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
942596866 2:177599815-177599837 GTCAGGGAGCAGCAAGAGGCTGG - Intergenic
942977553 2:182037099-182037121 CTCTAGGAGCAAAAAGAAGAAGG + Intronic
943439830 2:187915214-187915236 GCAGAGGAGGAGGAAGAGGAGGG + Intergenic
943553941 2:189377715-189377737 GTGAAGGAGGAGAAAGTGGAGGG - Intergenic
944095178 2:195958217-195958239 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
944495180 2:200300196-200300218 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
944900999 2:204216039-204216061 TTGGAGGAGAAGGAAGAGGAAGG - Intergenic
945911663 2:215656844-215656866 TTTGAGGAGCAGAAAGAGAGGGG - Intergenic
946140050 2:217682532-217682554 GGCGAGGAGGGGGAAGAGGATGG + Intronic
946587923 2:221211186-221211208 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
948048087 2:234958672-234958694 GTCAAGGAGGAGAAAGATGGGGG + Intronic
948566698 2:238891809-238891831 CTCTAGGAGCAAACAGAGGAAGG - Intronic
948571162 2:238917952-238917974 CACGAGGAGCAGAAACAGGTGGG + Intergenic
948819189 2:240529962-240529984 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
948939277 2:241188001-241188023 GGCTAGGAGGAGAAAGAGGAGGG + Intergenic
1168822763 20:786830-786852 TTCAAACAGCAGAAAGAGGATGG - Intergenic
1168873079 20:1147516-1147538 ATTGAGGAGGAGAAAGGGGATGG - Intronic
1169491705 20:6076624-6076646 GTCTAGGGGTAGAAAGGGGAGGG - Exonic
1169777652 20:9273600-9273622 GTGAAGGAGGAGGAAGAGGAAGG + Intronic
1170081625 20:12482928-12482950 GTTGAGAAGCTTAAAGAGGAAGG + Intergenic
1170483931 20:16795750-16795772 GACAAGGAGGAGAAAGAGGAGGG + Intergenic
1170682260 20:18536964-18536986 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1170841131 20:19925042-19925064 GAGGAGGAGCACAAAGAGGTGGG - Intronic
1170962241 20:21035768-21035790 ATTGAGGAGCAAAAAGAGGAAGG + Intergenic
1171115093 20:22518705-22518727 GTTGAGGAGCAGGGAGAGGGTGG + Intergenic
1171933538 20:31250933-31250955 GCTGAGGAGGAGAAAAAGGAGGG - Intergenic
1172169594 20:32920973-32920995 GTCCAGGGTCAGAAAGGGGAAGG - Intronic
1172787016 20:37475154-37475176 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1173134202 20:40424905-40424927 GAAGAGGAGGAGAAGGAGGAGGG + Intergenic
1174159471 20:48540764-48540786 GTTGAGCAGGAGAAAGAGAAGGG - Intergenic
1174354855 20:49990781-49990803 GTCCAGGAGGAGAAAGACAAAGG + Intergenic
1174732937 20:52935883-52935905 TTCTAGGTGCAGAAACAGGAAGG - Intergenic
1174736813 20:52972747-52972769 GTGGAGGAGGAGGAGGAGGAGGG + Exonic
1175226063 20:57444657-57444679 GTGTGGGAGCGGAAAGAGGATGG + Intergenic
1175371179 20:58494139-58494161 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1176037868 20:63049159-63049181 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1176415340 21:6471480-6471502 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1177677594 21:24321920-24321942 GTCGATGATTAGAATGAGGAAGG + Intergenic
1178021898 21:28417843-28417865 GTCTAGGATCACAGAGAGGACGG + Intergenic
1178225363 21:30710904-30710926 GAGGAGGAGAGGAAAGAGGAGGG + Intergenic
1178493707 21:33070370-33070392 GTGGAGGAGGAGGAGGAGGAGGG - Exonic
1178505256 21:33157401-33157423 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178505261 21:33157420-33157442 GAGGAGGAGGAGAAAGAGGGAGG - Intergenic
1178777063 21:35561948-35561970 GAGGAGGAGGAGAGAGAGGAAGG + Intronic
1179087940 21:38237059-38237081 GTCCACCAGCAGCAAGAGGAAGG + Intronic
1179391505 21:40996434-40996456 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1179487799 21:41722119-41722141 GTTGAGGAGGAAAAGGAGGAGGG - Intergenic
1179487900 21:41722559-41722581 GTAGAGGAGCTGAGAGAGGCCGG + Intergenic
1179690840 21:43079813-43079835 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1179915379 21:44474280-44474302 GGCGAGGGGCAGAATCAGGAGGG + Intergenic
1179986215 21:44921595-44921617 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1180210987 21:46295479-46295501 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1180294825 22:10874408-10874430 GTCTTGGAGGAGACAGAGGAGGG + Intergenic
1180497631 22:15903822-15903844 GTCTTGGAGGAGACAGAGGAGGG + Intergenic
1180760297 22:18197208-18197230 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1180770610 22:18381506-18381528 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1180775372 22:18427488-18427510 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1180808441 22:18738543-18738565 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1180828553 22:18884464-18884486 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1181071370 22:20343507-20343529 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1181194443 22:21172457-21172479 GTCAAGGATCTGAAAGAGGAAGG + Intergenic
1181214999 22:21320321-21320343 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1181284262 22:21740729-21740751 ATGGAGGAGGAGAGAGAGGAAGG - Intergenic
1181399948 22:22645252-22645274 GTCAAGGAGGAGACAGAGGATGG - Intronic
1181649417 22:24250537-24250559 GTCAAGGAGGAGACAGAGGATGG + Intergenic
1181701922 22:24626352-24626374 GTCAAGGAGGAGACAGAGGATGG - Intronic
1181711861 22:24696182-24696204 GTGGAGGAGGAGAAAGGGGTGGG - Intergenic
1181886074 22:26023476-26023498 GTAGAGGAGGAGGAGGAGGAGGG - Intronic
1182985872 22:34715760-34715782 GAGGAGGAAGAGAAAGAGGAGGG - Intergenic
1183483811 22:38078707-38078729 GGGGAGGAGGAGGAAGAGGAGGG + Intronic
1183645452 22:39123766-39123788 GCAGAGGAGCACAAGGAGGAAGG + Intronic
1183934478 22:41254462-41254484 GACGAGGAGGAGGAGGAGGAAGG - Exonic
1184295925 22:43525541-43525563 AAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1184380209 22:44140646-44140668 GATGAGGAGCAGAGAGAGGAAGG - Intronic
1184883819 22:47329815-47329837 GAAGAGGAGCAGAAGGAGGAAGG + Intergenic
1185121039 22:48970276-48970298 ATCAAGGAACAAAAAGAGGATGG - Intergenic
1203232445 22_KI270731v1_random:122678-122700 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
1203278647 22_KI270734v1_random:110453-110475 GTCAAGGATCTGAAAGAGGAAGG - Intergenic
949631019 3:5926628-5926650 GTGGAGGAGGAGGAAGAGGAGGG - Intergenic
950198831 3:11028573-11028595 TTCCAGGTGCAGAAAGAGGGTGG - Intronic
950572899 3:13813030-13813052 TTAGAGGAACAGAAGGAGGAGGG + Intergenic
951033010 3:17903788-17903810 GAGGAGGAGGACAAAGAGGAAGG - Intronic
951682118 3:25305718-25305740 GTTGAAGAGCAGAAAGAGCTTGG + Intronic
951738469 3:25894194-25894216 TCCAAGGAGCAGAAAGAGGAAGG + Intergenic
951854646 3:27181451-27181473 GACGAGGAAGAGGAAGAGGAGGG + Intronic
952542047 3:34376991-34377013 GTCGAAGGGAAGAAGGAGGATGG - Intergenic
952655983 3:35785935-35785957 GGTGAGGAAAAGAAAGAGGATGG + Intronic
953134686 3:40172368-40172390 GTCTGGGAGCAGTAAGAGGAAGG + Intronic
953230250 3:41058328-41058350 GTGGAGGAGGAGGAGGAGGAGGG + Intergenic
953230260 3:41058362-41058384 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
953694425 3:45146456-45146478 GAGGAGGAGGAGAGAGAGGAGGG - Intergenic
954093664 3:48305111-48305133 TGCGAGGAGCAGAAAGAAAAAGG - Intergenic
955300221 3:57771191-57771213 GAGGAGGAGGAGAAAGAGAAGGG - Intronic
955382549 3:58451463-58451485 GCTGAGGAGGAGGAAGAGGAAGG + Intergenic
955552316 3:60097550-60097572 GTAAAGGAGGAGGAAGAGGAGGG - Intronic
955846184 3:63165178-63165200 GAGGAGGAGGAGGAAGAGGAAGG - Intergenic
955931976 3:64066495-64066517 GTAGAGTGGCAGAAAGAGCAGGG + Intergenic
955959616 3:64326841-64326863 GAGGAGGAGGAGGAAGAGGATGG + Intronic
956440926 3:69279752-69279774 GGGGAGGAGGAGAAGGAGGAGGG - Intronic
956514003 3:70025940-70025962 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
956659124 3:71582229-71582251 GTCGAGGGCCAAAAAGAAGAAGG + Intronic
957347856 3:78984926-78984948 TAGGAGGAGGAGAAAGAGGAGGG - Intronic
957501710 3:81066521-81066543 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
957805892 3:85148871-85148893 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
958075835 3:88677033-88677055 GAGGAGGAGCAGAAAAAGGAAGG - Intergenic
958135808 3:89489263-89489285 GGAGGGGAGGAGAAAGAGGAAGG + Intergenic
958683265 3:97357924-97357946 GCTGAGGAGAAGAAAGAAGAGGG + Intronic
959110004 3:102111576-102111598 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
959646946 3:108713928-108713950 GTCGTGTAGCAGAAAGAGCATGG - Intergenic
959668434 3:108947346-108947368 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
960266384 3:115625140-115625162 GAGAAGGAGCAGGAAGAGGATGG + Intronic
960936415 3:122906703-122906725 GGGGAGGAGGAAAAAGAGGAGGG + Intergenic
960988994 3:123298396-123298418 GGGAAGGAGCAGTAAGAGGAGGG + Intronic
961239440 3:125397622-125397644 GGAGAGCAGCAGGAAGAGGAAGG + Intergenic
961348391 3:126279940-126279962 GAGGAGGAGGAGGAAGAGGAAGG - Intergenic
961642197 3:128371678-128371700 GTTGGGGTGCAGAATGAGGAGGG + Intronic
961893516 3:130149260-130149282 TTCAAGGAACAGAAAGAGGGTGG + Intergenic
962236471 3:133711593-133711615 CTAGAGGAGCACAAAGGGGAGGG - Intergenic
962708880 3:138069139-138069161 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
963189152 3:142450118-142450140 GCCCACGAGCACAAAGAGGAGGG + Intronic
963798933 3:149658142-149658164 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
964023647 3:152044983-152045005 GAAGAGGAAGAGAAAGAGGAAGG + Intergenic
964724398 3:159799400-159799422 GTAGAGGATTACAAAGAGGATGG + Intronic
964947234 3:162240763-162240785 TTGCAGGAGCAGAAACAGGATGG + Intergenic
965611400 3:170547625-170547647 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
965677555 3:171213728-171213750 GTCTGGGATCAGAAAGAAGAGGG + Intronic
966225297 3:177591317-177591339 TTGGAGGAGCAAAGAGAGGAGGG - Intergenic
966234617 3:177686796-177686818 GTCCAGGAGCAGCCAGGGGAAGG - Intergenic
966258938 3:177952077-177952099 GGCAAGGAGAAGAAAGATGATGG - Intergenic
966370944 3:179250150-179250172 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
966521915 3:180882423-180882445 GAGGAGGAGGAGAAGGAGGAAGG - Intronic
967192662 3:186998508-186998530 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
968144815 3:196289123-196289145 GTGGCTGAGAAGAAAGAGGATGG + Intronic
968671278 4:1853109-1853131 GGGGAGGAGCAGAATGAGGAGGG - Intronic
968708465 4:2095206-2095228 GGAGAGGAGCAGAAACAGGAAGG + Intronic
969200902 4:5604940-5604962 GAGGAGGAGGAGTAAGAGGAAGG - Intronic
969324442 4:6432895-6432917 GCTGAGGAGAAGGAAGAGGACGG - Intronic
969520009 4:7671659-7671681 GCTGAGGAGCAGAAAGAATAAGG + Intronic
969979534 4:11140494-11140516 GAGGAGGAGGAGAAGGAGGAGGG - Intergenic
970000556 4:11361524-11361546 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
970231461 4:13915488-13915510 GCAAAGGACCAGAAAGAGGAGGG - Intergenic
970916184 4:21338002-21338024 ATGGTGGAGCAGAAAGTGGAAGG - Intronic
971086722 4:23286313-23286335 GAAAAGGAGGAGAAAGAGGAGGG + Intergenic
971436592 4:26632530-26632552 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
972166858 4:36297139-36297161 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
972319425 4:37959447-37959469 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
972362687 4:38342998-38343020 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
972835266 4:42862740-42862762 GTTGAGGAGAGGAGAGAGGAAGG - Intergenic
973267582 4:48226449-48226471 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
973666553 4:53165082-53165104 ATCCAGGAGCAGCAAGAGTAAGG - Intronic
974179852 4:58370654-58370676 GTGGAGGAATAGAGAGAGGAAGG - Intergenic
974229273 4:59088939-59088961 GGGGAGGAGGAGGAAGAGGAGGG - Intergenic
975443927 4:74441043-74441065 GAGGAGGAGAAGGAAGAGGAAGG - Intergenic
975663048 4:76706530-76706552 GCTGAGGAGGAGTAAGAGGATGG + Intronic
975794712 4:77994964-77994986 GTGGAAGAGAAGAAAGGGGAAGG + Intergenic
976691652 4:87874509-87874531 GTTGAGGAGAAGGAAAAGGAAGG + Intergenic
976786102 4:88823339-88823361 ATTGAGGAGCAGAAGGAGTAGGG - Intronic
977523588 4:98117513-98117535 GAAGCGGAGGAGAAAGAGGAAGG - Intronic
978311957 4:107394521-107394543 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
978420423 4:108526819-108526841 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
978682765 4:111402368-111402390 GAGAAGGAGCAGGAAGAGGAGGG + Intergenic
978734628 4:112071713-112071735 GAGGAGGAGGAGAAAGAGAAGGG - Intergenic
979722585 4:123919394-123919416 GGCGAGGAGGAAGAAGAGGAGGG - Intergenic
980183474 4:129432091-129432113 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
980487524 4:133478526-133478548 GCTGAGGAGAAGGAAGAGGAGGG - Intergenic
981498716 4:145423119-145423141 GAGGAGGAGAAGAAAGGGGAGGG + Intergenic
981673187 4:147311156-147311178 GGAGAGAAACAGAAAGAGGAGGG + Intergenic
982521668 4:156425007-156425029 GCTGAGGAGGAGGAAGAGGAAGG - Intergenic
983144519 4:164197131-164197153 GGCGAGGAGGAGGAGGAGGAAGG - Intronic
983913872 4:173269722-173269744 GTTGAGGAGGAGGAGGAGGAGGG - Intronic
984019701 4:174470242-174470264 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
984375742 4:178926637-178926659 GCAGAGGAGGAGGAAGAGGAGGG + Intergenic
984411066 4:179398687-179398709 GTCGTGGAGAAGGAAGTGGAGGG - Intergenic
984761234 4:183364598-183364620 GAAGAGGAAGAGAAAGAGGATGG - Intergenic
984989387 4:185364239-185364261 ATGGGGGAGCGGAAAGAGGAGGG + Exonic
985106887 4:186508928-186508950 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
985177285 4:187215238-187215260 GGAGAGGAGGAGAAGGAGGAAGG - Intergenic
985894913 5:2743213-2743235 GGCGGGGAGCGGAGAGAGGAAGG - Intergenic
986063546 5:4213896-4213918 GAGGAGGAGGAGAAAGAAGAGGG + Intergenic
986552900 5:8978627-8978649 CTGGAGGAGGAGAAAGAGGTGGG - Intergenic
986691399 5:10316625-10316647 GTCAAGAAGCAGAAGGAGCAGGG - Intergenic
987191279 5:15480877-15480899 GTTGAGGAGGAGGATGAGGATGG + Intergenic
987510838 5:18836312-18836334 GAGGAGGAGGAGAAAGTGGAGGG - Intergenic
987678358 5:21104775-21104797 ATAGAGGAGCAGGAAGATGAAGG + Intergenic
987953257 5:24703589-24703611 GGCAAGGAGCAGAAGGAGGTAGG - Intergenic
988485661 5:31666234-31666256 GTCTTGGAGCAGAAGGTGGAGGG + Intronic
989043342 5:37250524-37250546 ATAGAGGAGGAGGAAGAGGAGGG - Intergenic
989051708 5:37326953-37326975 GCTGAGGAGTAGGAAGAGGAAGG - Intronic
989325572 5:40189696-40189718 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
989379329 5:40798131-40798153 GCCGAGAAGCAGAAACACGACGG - Exonic
989483726 5:41963725-41963747 AAGGAGGAGCAGGAAGAGGAAGG + Intergenic
989504946 5:42216230-42216252 GTCGGGGAGCAAGAAGGGGAGGG + Intergenic
990037926 5:51345481-51345503 GTACAGGAGCATAAGGAGGAGGG + Intergenic
990456520 5:55994616-55994638 GTCCGGGAGCAGGAAGGGGAAGG + Intronic
991959512 5:72030444-72030466 GAAGAGGAGGAGGAAGAGGAAGG - Intergenic
992349716 5:75916396-75916418 GTGGAGGAGGAGGAGGAGGAAGG - Intergenic
992442162 5:76806466-76806488 GTGGATGAGCCAAAAGAGGAGGG - Intergenic
993021136 5:82592477-82592499 GAGGAGGAGGAGAAGGAGGAAGG - Intergenic
993249547 5:85501132-85501154 CTAGAGCAGCAGGAAGAGGATGG - Intergenic
993261850 5:85667672-85667694 GAAGAGGAGGAGAAAGGGGAGGG - Intergenic
993811261 5:92479499-92479521 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
993929730 5:93923074-93923096 GCTGAGGAGGAGAAAGAGGAGGG - Intronic
994104086 5:95926230-95926252 GTGGAGGAGTAGGAAGGGGAGGG + Intronic
994721962 5:103390820-103390842 ATTGTGGAGTAGAAAGAGGAAGG - Intergenic
994850273 5:105046317-105046339 GTCGAGGAGGAGGAGGAGGAGGG - Intergenic
995214729 5:109582345-109582367 GAAGAGGAGAAGGAAGAGGAGGG + Intergenic
995329013 5:110925868-110925890 GTTGAGGATCAGAAGTAGGATGG - Intergenic
996075238 5:119185183-119185205 GTAGAGGAGCAGAAAGTGACAGG - Intronic
997281968 5:132655076-132655098 GCCGAGGAGGAAGAAGAGGAGGG - Intergenic
997670376 5:135666485-135666507 ATCGAGGAGCAGAAGGATGTAGG - Intergenic
998821819 5:146064135-146064157 GAGGAGAAGGAGAAAGAGGAGGG + Intronic
999137219 5:149329952-149329974 GAGGAGGAGGAGAAGGAGGAGGG - Intronic
999203260 5:149831407-149831429 GTCCAGGACCAGGAAGAGGAGGG - Intronic
999261538 5:150241669-150241691 GTTGAGGAGAGGGAAGAGGAAGG - Intronic
999286389 5:150396695-150396717 GTCAAGGAGAAGAAAGGGAAGGG + Exonic
999432636 5:151537276-151537298 GTGGAGGAGGAGGAGGAGGAGGG + Intronic
999558284 5:152769182-152769204 GTTGAGGAGAAAAAAGAAGAGGG - Intergenic
1000011054 5:157233238-157233260 GACAAGGAGCAGAAAGTGGCAGG - Intronic
1000152148 5:158513834-158513856 AACGAGGAGGAGAAACAGGAGGG + Intergenic
1000202633 5:159026821-159026843 GGCAAGGAGCAGAAAAAGGAAGG - Intronic
1000747655 5:165055053-165055075 GAGGAGGAGTAGAAGGAGGAAGG - Intergenic
1000847551 5:166300367-166300389 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1001016851 5:168149658-168149680 GGTGAGGAACAGAGAGAGGATGG - Intronic
1001066087 5:168536075-168536097 GACAAGGAACAGACAGAGGAAGG + Intergenic
1002328909 5:178428435-178428457 TCCGAGCAGCAGAATGAGGAAGG - Intronic
1002559190 5:180070076-180070098 GTGGAAGGGTAGAAAGAGGAAGG - Intronic
1002664683 5:180814423-180814445 GAGGAGGAGCAGCCAGAGGAGGG - Intronic
1002817104 6:691416-691438 GTGGAGGAGGAAGAAGAGGAGGG - Intronic
1003012621 6:2439835-2439857 GTGGAGGATCAAAAAGGGGAGGG + Intergenic
1003849621 6:10208508-10208530 GAGGAGGAGCAGGCAGAGGAGGG + Intronic
1003872779 6:10415113-10415135 GTGGAGGAGGAGAAGGAGGAGGG + Exonic
1003872791 6:10415152-10415174 GAGGAGGAGGAGGAAGAGGAGGG + Exonic
1004068661 6:12276282-12276304 TTCCAGTAGCAGAAAGAGAAAGG + Intergenic
1004141662 6:13023700-13023722 GTCTATGAGCAGAAAGAGTGCGG + Intronic
1004584006 6:16981950-16981972 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1004722700 6:18281763-18281785 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1005081954 6:21965396-21965418 GAGGAGGAGAAGAAGGAGGAGGG - Intergenic
1005345331 6:24883869-24883891 GTGGGGGAGCATAAACAGGATGG - Intronic
1005768946 6:29045271-29045293 GTAGAGGAGGAGAAGGAGGAGGG + Intergenic
1006341221 6:33448209-33448231 GTCTAGGGGCAGAAAGACCAAGG - Intronic
1006485011 6:34332394-34332416 GAAGAGGAGGAGGAAGAGGAGGG + Intronic
1006815989 6:36850353-36850375 GTGGAGGCGCAGCAGGAGGAAGG - Intergenic
1006868994 6:37233228-37233250 GTTGAGGATGAGCAAGAGGAAGG - Intronic
1006888485 6:37402445-37402467 GGTAAGGAGCAGAAAGGGGAAGG - Intergenic
1007827105 6:44608762-44608784 GAGGAGGAGGAGAAGGAGGATGG - Intergenic
1007965365 6:45999613-45999635 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
1008124048 6:47648946-47648968 GCTGAGGAGGAGGAAGAGGAGGG - Intergenic
1008266744 6:49436948-49436970 GTAGAGGAGCAGGAGGAGGGAGG + Intronic
1008585992 6:52949964-52949986 GCTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009056785 6:58345908-58345930 ACTGAGGAGGAGAAAGAGGAGGG - Intergenic
1009234456 6:61105664-61105686 GAGAAGGAGGAGAAAGAGGAGGG + Intergenic
1009728993 6:67574717-67574739 GAGGAGGAGGAGAAAGAGAAGGG + Intergenic
1009834196 6:68976740-68976762 GCTGAGAAGGAGAAAGAGGAGGG + Intronic
1009859143 6:69303420-69303442 GCTGAGGAGGAGAAAGAAGAGGG - Intronic
1011814386 6:91171629-91171651 GGCGAGGAGTGGAGAGAGGAAGG + Intergenic
1011854299 6:91669601-91669623 CAGGAGGAGCAGAAAGAAGAGGG - Intergenic
1011880516 6:92018190-92018212 GTCGGGGAGCAAACACAGGAGGG + Intergenic
1012107203 6:95178122-95178144 GAGGAGGAGGAGGAAGAGGATGG + Intergenic
1012538841 6:100335795-100335817 GTCCAGGACCACAATGAGGAAGG + Intergenic
1012609988 6:101205461-101205483 ATCAAGGAGCTGACAGAGGAGGG + Intergenic
1012708996 6:102573522-102573544 TTCGAGGAGGAGAAAGAAGAGGG - Intergenic
1012982620 6:105846251-105846273 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1012984453 6:105859883-105859905 GAAGAGGAAAAGAAAGAGGAGGG + Intergenic
1013351705 6:109311802-109311824 GTGATGAAGCAGAAAGAGGAAGG - Intergenic
1014311818 6:119813193-119813215 GAGGAGGAGGAGAAAGAGAAGGG + Intergenic
1014617553 6:123622128-123622150 GAGGAGGAGGAAAAAGAGGAAGG - Intronic
1014636690 6:123856160-123856182 GTCTAGGAGGAAAAAAAGGAAGG - Intronic
1015233986 6:130949785-130949807 GAAGAGGAGGAGGAAGAGGAGGG - Intronic
1015445577 6:133300211-133300233 GAGGAGGAGGAGAAAGAGGAGGG + Intronic
1015554980 6:134451786-134451808 GTTGGGGAGCAGAGAGTGGAGGG + Intergenic
1015559391 6:134498123-134498145 GGAGAGAAGAAGAAAGAGGAAGG - Intergenic
1015857104 6:137636511-137636533 GAGGAGGAGGAGAAAGAGGAGGG + Intergenic
1015977648 6:138807069-138807091 GAGGAGGAAGAGAAAGAGGAAGG + Intronic
1016330103 6:142945960-142945982 GAGGAGGAGGAGAAGGAGGACGG + Intergenic
1016801484 6:148173538-148173560 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1017032498 6:150236575-150236597 GAGGAGGAGCTGAAAGCGGAGGG + Intronic
1017103307 6:150866428-150866450 GGCGAGGAGCAGGAGGAGGGCGG + Intronic
1017179759 6:151540332-151540354 GAGGAGGAGGAGGAAGAGGAAGG - Intronic
1017328802 6:153171724-153171746 ATCGAGGATGAGAAAGAAGAAGG + Intergenic
1017587444 6:155942789-155942811 GAAGAGGAGCAGGAGGAGGAAGG + Intergenic
1018067495 6:160134101-160134123 GTAGTAGAGCAGGAAGAGGAAGG - Exonic
1018860141 6:167705318-167705340 GCCGAGCAGCAGTAGGAGGAGGG + Intergenic
1018861770 6:167715652-167715674 GTGGAGGAGGAGGAAGAGGAGGG + Intergenic
1018969332 6:168515446-168515468 CTCGTGGAGCGGAAAGCGGACGG - Intronic
1019018178 6:168895831-168895853 GTGGATGAGCAGAAAGGTGATGG - Intergenic
1019344693 7:523473-523495 GTCAAGGGGCAGAGAGCGGAGGG - Intergenic
1020577336 7:9949778-9949800 GAGGAGGAGGAGAAGGAGGAGGG + Intergenic
1020685326 7:11286590-11286612 GACAAGGAGCAGAAATTGGATGG - Intergenic
1021128344 7:16880503-16880525 GGAGAGGAGGGGAAAGAGGAGGG - Intronic
1021171182 7:17399543-17399565 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1021482919 7:21137354-21137376 CAGGAGGAGGAGAAAGAGGAAGG - Intergenic
1021809024 7:24385040-24385062 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1021849754 7:24795874-24795896 GCTGAGGAGAAGGAAGAGGAGGG - Intergenic
1022015682 7:26346591-26346613 GTAGAGGAGCAGGTACAGGAGGG - Intronic
1022089321 7:27097213-27097235 GACGTGCAGCAGAATGAGGAAGG - Intergenic
1022665930 7:32410442-32410464 GTGGAGGAGGAGGAAGAGGAAGG + Intergenic
1023045174 7:36204423-36204445 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1023318825 7:38971341-38971363 GTCAAGGAGAACAAAGAAGAAGG - Intergenic
1023386712 7:39665201-39665223 GAAGAGGAGGAGGAAGAGGAAGG - Intronic
1023567364 7:41536902-41536924 GTGGAGGATGAGAAAGAAGATGG + Intergenic
1023586856 7:41739781-41739803 GAGGAGGAGGAGAAAAAGGAGGG + Intergenic
1023688716 7:42763901-42763923 GTAGAGGAAGAGGAAGAGGAAGG + Intergenic
1024720953 7:52137073-52137095 GGAGAGGAGGAGAAGGAGGAGGG + Intergenic
1025271208 7:57519148-57519170 GTGGAGGCGCTGAAAGAGGCAGG - Intergenic
1025855143 7:65269734-65269756 GTCGCGGCGCGGGAAGAGGACGG - Intergenic
1025916035 7:65866854-65866876 GTCGAGGAGGAAGAGGAGGAGGG + Intergenic
1026284147 7:68948375-68948397 AAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1027639365 7:80714127-80714149 TTTGACGAGCAGAAAGAAGAAGG + Intergenic
1027903430 7:84148733-84148755 GAGGAGGATCAGGAAGAGGAGGG - Intronic
1028052839 7:86206963-86206985 GAAGAGGAACAGAAAGAGAAAGG + Intergenic
1028807395 7:95044275-95044297 GTAGAGGAGGAGAAAGTAGAGGG - Intronic
1029356642 7:100057088-100057110 GTCGAGGAGAAAGAAGAGAAAGG + Exonic
1029524551 7:101087077-101087099 GAGGAGGAGGAGAAGGAGGAGGG + Exonic
1029657170 7:101934934-101934956 GGTGAGGAGCAGGAGGAGGAAGG + Intronic
1030266583 7:107628402-107628424 GTAGAGGAGGAGAGGGAGGAGGG + Intronic
1030311130 7:108070496-108070518 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1030314008 7:108095774-108095796 GTAGAGGAGAAGAAGGAGGGGGG - Intronic
1030558540 7:111056846-111056868 GCTGAGGAGGAGGAAGAGGAGGG + Intronic
1031537417 7:122952438-122952460 GAAGAGGAGGAGAAGGAGGAAGG + Intergenic
1032456366 7:132076153-132076175 GTGGAGGGGCAGAAAGAGCATGG - Intergenic
1032523275 7:132561942-132561964 GAGGAGGAGGAGAAAGAGGAGGG - Intronic
1032523301 7:132562053-132562075 GAAGAGGAGGAGAAGGAGGAGGG - Intronic
1032683525 7:134209218-134209240 GTAGAGGTTCAGACAGAGGAGGG - Intronic
1033000831 7:137502541-137502563 GGAGAGGAGGAGAAAGGGGAAGG + Intronic
1033604214 7:142913894-142913916 AGGGAGGGGCAGAAAGAGGAAGG - Intronic
1033832641 7:145271817-145271839 GGGGAGGAGGAGGAAGAGGAAGG + Intergenic
1034021631 7:147650457-147650479 GAGGAGGAGGAGGAAGAGGAGGG - Intronic
1034823580 7:154239400-154239422 GATGAGGAGGAGGAAGAGGAAGG - Intronic
1035521866 8:281061-281083 GATGAGGAGAAGAAAGAAGACGG + Intergenic
1035570170 8:667410-667432 GTGGAGGAGCGGGAAGAGGAGGG - Intronic
1035782334 8:2238382-2238404 GACGAGGAACAAAAAGAGAAAGG + Intergenic
1035809783 8:2481206-2481228 GACGAGGAACAAAAAGAGAAAGG - Intergenic
1036444588 8:8810490-8810512 GCTGAGGAGGAGGAAGAGGAGGG - Intronic
1037046579 8:14312704-14312726 GAGGAGGAGGAGGAAGAGGAAGG + Intronic
1037541757 8:19878858-19878880 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1037581685 8:20249330-20249352 GTCCAGGAGGAAAAAGAGGTTGG + Exonic
1037691214 8:21183206-21183228 GGGGAGGAGGAGGAAGAGGAGGG - Intergenic
1037911545 8:22746624-22746646 GGAGAGGAGGAGAGAGAGGAGGG - Intronic
1037933664 8:22899673-22899695 GGTGAGGAGGAGAGAGAGGAGGG + Intronic
1038114503 8:24538178-24538200 GTTGAGGAACAGAATGAGGTAGG + Intergenic
1038174559 8:25168529-25168551 GTGGAGGAGAAGAAAGGGAAAGG + Intergenic
1038234321 8:25737198-25737220 GAAGAGGAAGAGAAAGAGGAGGG - Intergenic
1038336160 8:26647350-26647372 GGGGAGGAGCAGCAAGAGGTTGG - Intronic
1038535704 8:28351623-28351645 GTGGAAGAGCAGACAGAGGCAGG + Exonic
1038679332 8:29652425-29652447 GAGGAAGAGAAGAAAGAGGAAGG + Intergenic
1039096424 8:33891573-33891595 GAGGAGGAGGAGGAAGAGGAAGG + Intergenic
1039340112 8:36638741-36638763 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1039485217 8:37904542-37904564 ATGGAGGAGCAGAAAGGGGCTGG + Intergenic
1039585238 8:38701753-38701775 GTGGAGCAGCAGGAAGTGGACGG + Intergenic
1040079772 8:43274918-43274940 GAGGAGGAGCAGGAGGAGGAGGG - Intergenic
1040870071 8:52091647-52091669 GTCGAGGAGAGGCAAGAGGAAGG - Intergenic
1040951373 8:52941148-52941170 GCCGAGGTGGAGGAAGAGGAGGG + Intergenic
1041311109 8:56517503-56517525 GAGGAGGAGGGGAAAGAGGAGGG - Intergenic
1041312952 8:56535012-56535034 GAGGAGGAAGAGAAAGAGGAGGG + Intergenic
1041353481 8:56973991-56974013 GAGGAGGAGGAGAAAGAGAAAGG - Intronic
1041614954 8:59895631-59895653 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1042987958 8:74604454-74604476 GTGGAGGAGGAGGAGGAGGAAGG + Intronic
1043082708 8:75785374-75785396 TAAGAGGAGGAGAAAGAGGAGGG - Intergenic
1043224451 8:77706429-77706451 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1043656957 8:82679672-82679694 GAAGAGGAGAAGAAGGAGGAGGG + Intergenic
1043765232 8:84122360-84122382 GTAAAGGAGCAGAAAGACGCTGG + Intergenic
1043935403 8:86136911-86136933 GTCGCAGATCAGAAGGAGGAAGG - Intronic
1044106112 8:88209261-88209283 GTGGAGGAGGAGGAAGAGAAGGG - Intronic
1044399985 8:91759263-91759285 GAGGAGGAGGAGAAAGATGAGGG + Intergenic
1045316984 8:101052058-101052080 GTGGAGCAGCATAAAGATGAAGG - Intergenic
1047085020 8:121506530-121506552 GTCAAGAGGCAGAAAGAGAAAGG - Intergenic
1047299860 8:123604415-123604437 GAGGAGGAGAAGGAAGAGGAAGG + Intergenic
1047322236 8:123797473-123797495 GAAGAGGAGGAGGAAGAGGAAGG - Intronic
1047328661 8:123864965-123864987 TTTGAGGAGCTGAGAGAGGAAGG - Intronic
1047336243 8:123939464-123939486 TTCGGGGAGCATAAAGGGGAAGG + Intronic
1047868018 8:129050314-129050336 GACAAGGAGGAGAAAAAGGAGGG - Intergenic
1048220096 8:132533183-132533205 GAGGAGGATGAGAAAGAGGAAGG + Intergenic
1048387728 8:133928202-133928224 GCCGACCAGCAGAAACAGGATGG - Intergenic
1048781180 8:138003677-138003699 GTGGAGCAGCAGAAAGTGGAAGG - Intergenic
1049121954 8:140747457-140747479 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1049121970 8:140747505-140747527 GAAGAGGAGGAGGAAGAGGAGGG + Intronic
1049414256 8:142488156-142488178 GTCCAGGAGCAGAGACAGCAAGG - Intronic
1049816680 8:144606350-144606372 GCCGAGGAGAAGGAAGAGGAAGG - Intergenic
1050405758 9:5307055-5307077 GGTGTGGAGCATAAAGAGGAAGG + Intergenic
1051318093 9:15865506-15865528 GAGGAGGAGAAGGAAGAGGAGGG - Intronic
1051544556 9:18259602-18259624 AGAGGGGAGCAGAAAGAGGAGGG - Intergenic
1052442040 9:28510499-28510521 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1052648332 9:31267913-31267935 GCCAAGTAGCAGAAAGAAGAAGG + Intergenic
1052918200 9:33939994-33940016 GAGGAGGAGGGGAAAGAGGAGGG + Intronic
1052925916 9:34016216-34016238 GAAGAGGAGGAGGAAGAGGAAGG + Intronic
1052988956 9:34507523-34507545 GAAGAGGAGGAGAAAGAGGAGGG + Intronic
1053559683 9:39177402-39177424 GTCGAGGAGCTCGATGAGGACGG + Exonic
1053823790 9:41997652-41997674 GTCGAGGAGCTCGATGAGGACGG + Exonic
1053904440 9:42826761-42826783 GACAAGGAGGAGAAAGAGGGTGG + Intergenic
1054137432 9:61441541-61441563 GTCGAGGAGCTCGATGAGGACGG - Intergenic
1054530545 9:66178753-66178775 GACAAGGAGGAGAAAGAGGGTGG - Intergenic
1054870329 9:70043243-70043265 GAGGAGGAGGAGGAAGAGGAGGG + Intergenic
1054991475 9:71331964-71331986 GAGGAGGAGGAGAAGGAGGAGGG + Intronic
1055018225 9:71642191-71642213 ATGGGGGAGCAGGAAGAGGAGGG + Intergenic
1055377449 9:75665166-75665188 TTCTAGGAGCAGAACCAGGAAGG - Intergenic
1056464689 9:86842252-86842274 GAGGAGGAGGAGGAAGAGGAGGG - Intergenic
1056882333 9:90408202-90408224 TTTGAGGGGTAGAAAGAGGAAGG + Intergenic
1056964452 9:91154424-91154446 GTCGAGGAGGAGGAAGAAGAGGG + Intergenic
1057014060 9:91635022-91635044 GCGGAGGAGGAGGAAGAGGAGGG + Intronic
1057601272 9:96459637-96459659 GTCAAGAAGCAGAAAGAGTTTGG - Intronic
1057791849 9:98129896-98129918 GAGGAGGAGAAGGAAGAGGAGGG + Intronic
1058483903 9:105424164-105424186 GAAGAGGACCAGAGAGAGGAGGG - Intronic
1059155938 9:111988355-111988377 GGCGCAGAGTAGAAAGAGGATGG - Intergenic
1059431532 9:114253414-114253436 GAAGAGGAGAAAAAAGAGGAGGG + Intronic
1059610635 9:115889065-115889087 CTCAAGGACCAGAAATAGGATGG - Intergenic
1060946154 9:127570090-127570112 GTCAACAAGCAGAAAGTGGATGG - Intronic
1061246257 9:129402520-129402542 GCCGAGGAGGAGGAAGAGGAGGG - Intergenic
1061613627 9:131764748-131764770 GTGGAGAAGGAGGAAGAGGAGGG - Intergenic
1062035440 9:134380649-134380671 GTCGTGGGGCAGCAATAGGAGGG - Intronic
1062450324 9:136612755-136612777 GGGGAGGAGAAGGAAGAGGAGGG - Intergenic
1185688335 X:1948467-1948489 GGGGAGGAGGAGGAAGAGGAGGG + Intergenic
1185688613 X:2133989-2134011 GGGGAGGAGGAGGAAGAGGAGGG + Intergenic
1185701260 X:2232133-2232155 AGAGAGGAGGAGAAAGAGGAAGG - Intronic
1186168729 X:6855107-6855129 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1186204107 X:7183313-7183335 GTCCAGCAGCAGACAGAGGGAGG - Intergenic
1186258880 X:7754448-7754470 TTCTGGGAGCATAAAGAGGATGG + Intergenic
1186645430 X:11501838-11501860 GAGAAGGAGCAGGAAGAGGAGGG + Intronic
1186663832 X:11698512-11698534 GTAGTAGAGCAGAAAGAGGTGGG - Intergenic
1186705697 X:12137964-12137986 CTCGAGGAGCATAGAGCGGAGGG - Intergenic
1186915037 X:14209684-14209706 GTCAGAGAGAAGAAAGAGGAAGG + Intergenic
1187468401 X:19546501-19546523 GTCAAGGAAAAGGAAGAGGAGGG - Intronic
1187620089 X:21042959-21042981 GCTGAGGAGTAGGAAGAGGAGGG + Intergenic
1187707778 X:22024968-22024990 ATCAAGGAGCAGAAGGAGCAAGG - Intergenic
1188159572 X:26783582-26783604 GTAGAGGAGCACAAAAAGGGAGG + Intergenic
1188660947 X:32757950-32757972 GAGGAGGAGGAGGAAGAGGAGGG + Intronic
1189431361 X:40950352-40950374 GTAGAAGAGCTGTAAGAGGAGGG - Intergenic
1189534599 X:41923507-41923529 CGGGAGGAGGAGAAAGAGGAGGG - Intergenic
1189709704 X:43796555-43796577 AAGGAGGAGGAGAAAGAGGAGGG + Intronic
1190058119 X:47193935-47193957 GGGGAGGAGGAGAAGGAGGAGGG + Exonic
1192054164 X:67756455-67756477 GTAGAGGAGGAGAAAGACCAGGG - Intergenic
1192204149 X:69085183-69085205 GAGGAGGAGAAGAAAGAGGAGGG - Intergenic
1192434620 X:71135508-71135530 GTGGAGCAGAGGAAAGAGGAGGG - Intronic
1192438080 X:71154899-71154921 GGGGGGCAGCAGAAAGAGGAAGG - Intronic
1192639091 X:72846163-72846185 GAGGAGGAGAAGAAGGAGGAGGG + Intronic
1192642620 X:72874642-72874664 GAGGAGGAGAAGAAGGAGGAGGG - Intronic
1192709292 X:73563213-73563235 GCCGAGGTGCTGCAAGAGGAGGG - Exonic
1192956460 X:76075932-76075954 GTTGGGGAGCAGAAAGTTGAGGG - Intergenic
1193814291 X:86086309-86086331 GTCAATGAGCTGAAAGAGAAGGG - Intergenic
1193846540 X:86479030-86479052 GTTGGGGAGCAGAAGGGGGATGG + Intronic
1195061140 X:101196018-101196040 GTGAGGGAGCAGAAAGAGGTGGG - Intergenic
1195263357 X:103155962-103155984 GAAGAGGAGGAGCAAGAGGAGGG - Intergenic
1195668370 X:107449975-107449997 GAAGAGGAGGAGGAAGAGGAGGG + Intergenic
1195759236 X:108228028-108228050 GTTGAAGGGCAGAAAGAGAATGG + Intronic
1196065446 X:111459144-111459166 GAGGAGAAGGAGAAAGAGGAGGG - Intergenic
1196908288 X:120460289-120460311 AACGAGGAGGAGGAAGAGGAGGG + Intronic
1196964184 X:121037817-121037839 GAGGAGGAGGAGAAAGAGGAGGG - Intergenic
1197264055 X:124347269-124347291 GTCGAGATGCTGAGAGAGGAGGG + Intronic
1197436505 X:126434832-126434854 GAGGAGGAGGAGATAGAGGAGGG + Intergenic
1197457601 X:126697206-126697228 GAGGAGGAGAAGGAAGAGGAGGG + Intergenic
1197942520 X:131804147-131804169 GTCAAGGAGCAGAGTGAGGGGGG + Intergenic
1198483251 X:137060500-137060522 GAGGAGGAGGAGAAAGAAGAGGG - Intergenic
1198921892 X:141738373-141738395 TGAGAGGAGCAGAAAGTGGAGGG - Intergenic
1199814933 X:151388794-151388816 GCAGAGGAGCAGAAACAGGGTGG + Intergenic
1200105699 X:153710865-153710887 ATCGGGGAGCAGAAGGAAGAGGG - Intronic
1200133542 X:153863932-153863954 GACGAGGAGCAGGAGGATGATGG + Exonic
1200691282 Y:6307670-6307692 ATCAAGAAGAAGAAAGAGGATGG - Intergenic
1201018244 Y:9625832-9625854 GCCAAGAAGAAGAAAGAGGACGG - Intergenic
1201043990 Y:9867046-9867068 ATCAAGAAGAAGAAAGAGGATGG + Intergenic
1201247911 Y:12024662-12024684 GAGGAGGAGTAAAAAGAGGAGGG - Intergenic
1201312742 Y:12611861-12611883 GAGGACGAGCAGAAAGAGGGTGG + Intergenic
1201559133 Y:15297528-15297550 GAAGAGGAGGAGGAAGAGGAGGG - Intergenic
1201576992 Y:15471453-15471475 GTCTAGCAGCAGACAGAGGGAGG - Intergenic
1201607306 Y:15801111-15801133 GCTGAGGAGGAGGAAGAGGAGGG + Intergenic
1201735799 Y:17260211-17260233 GCTGAAGAGAAGAAAGAGGAGGG + Intergenic
1202161648 Y:21941027-21941049 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202229708 Y:22645346-22645368 GTCAAGAAGGAGAAACAGGATGG + Intergenic
1202313448 Y:23550819-23550841 GTCAAGAAGGAGAAACAGGATGG - Intergenic
1202557355 Y:26119776-26119798 GTCAAGAAGGAGAAACAGGATGG + Intergenic