ID: 902816185

View in Genome Browser
Species Human (GRCh38)
Location 1:18918011-18918033
Sequence CAGAGGAAGGGGCAGGAAGC GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1339
Summary {0: 1, 1: 1, 2: 11, 3: 135, 4: 1191}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902816172_902816185 10 Left 902816172 1:18917978-18918000 CCAACCGTGGGGATGATGCCCAG 0: 1
1: 0
2: 0
3: 9
4: 95
Right 902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG 0: 1
1: 1
2: 11
3: 135
4: 1191
902816171_902816185 11 Left 902816171 1:18917977-18917999 CCCAACCGTGGGGATGATGCCCA 0: 1
1: 0
2: 1
3: 8
4: 54
Right 902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG 0: 1
1: 1
2: 11
3: 135
4: 1191
902816177_902816185 -9 Left 902816177 1:18917997-18918019 CCAGTTCTGGCACCCAGAGGAAG 0: 1
1: 0
2: 0
3: 18
4: 196
Right 902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG 0: 1
1: 1
2: 11
3: 135
4: 1191
902816169_902816185 20 Left 902816169 1:18917968-18917990 CCAGGGTTCCCCAACCGTGGGGA 0: 1
1: 0
2: 0
3: 14
4: 127
Right 902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG 0: 1
1: 1
2: 11
3: 135
4: 1191
902816176_902816185 -8 Left 902816176 1:18917996-18918018 CCCAGTTCTGGCACCCAGAGGAA 0: 1
1: 0
2: 2
3: 17
4: 263
Right 902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG 0: 1
1: 1
2: 11
3: 135
4: 1191
902816173_902816185 6 Left 902816173 1:18917982-18918004 CCGTGGGGATGATGCCCAGTTCT 0: 1
1: 0
2: 1
3: 13
4: 182
Right 902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG 0: 1
1: 1
2: 11
3: 135
4: 1191
902816170_902816185 12 Left 902816170 1:18917976-18917998 CCCCAACCGTGGGGATGATGCCC 0: 1
1: 0
2: 2
3: 6
4: 121
Right 902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG 0: 1
1: 1
2: 11
3: 135
4: 1191
902816165_902816185 25 Left 902816165 1:18917963-18917985 CCTGGCCAGGGTTCCCCAACCGT 0: 1
1: 0
2: 1
3: 4
4: 145
Right 902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG 0: 1
1: 1
2: 11
3: 135
4: 1191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902816185 Original CRISPR CAGAGGAAGGGGCAGGAAGC GGG Intronic
900084989 1:888612-888634 AAGAGGAAGGGAGAGGAAGGAGG + Intergenic
900102476 1:967741-967763 CAGAGGAGTGGGCAGGGAGAGGG + Intronic
900439368 1:2645698-2645720 AGCAGGAAGGGGCAGGAAGCTGG - Intronic
900646847 1:3712932-3712954 CAGAGGGTGGGGCAGGGGGCAGG - Intronic
900809095 1:4787604-4787626 CAGGGGCAGGGGCAGGATGAGGG + Exonic
901035143 1:6331887-6331909 CAGAAGAGACGGCAGGAAGCAGG + Intronic
901932934 1:12608557-12608579 CAGGGGCAGGGGCAGGGGGCAGG - Intronic
901935221 1:12621932-12621954 TGGAGGAAGGGTCAGGAAGGAGG - Intergenic
901946289 1:12706723-12706745 TAGAGGAAGGTGCAGGCAGTGGG + Intergenic
901967781 1:12882522-12882544 CAGAGAGAGGGACAAGAAGCAGG - Intronic
901983178 1:13052786-13052808 CAGAGAGAGGGACAAGAAGCAGG - Intronic
901985837 1:13074550-13074572 CAGAGACAGGGACAAGAAGCAGG + Intronic
901995972 1:13152217-13152239 CAGAGACAGGGACAAGAAGCAGG - Intergenic
901998911 1:13176132-13176154 CAGAGAGAGGGACAAGAAGCAGG + Intergenic
902009595 1:13260113-13260135 CAGAGAGAGGGACAAGAAGCAGG + Intronic
902052028 1:13571288-13571310 TAGAGGCAGGTGCAGGCAGCAGG - Intergenic
902328549 1:15718660-15718682 CAGAGGAGGGGGCAGGGTGGGGG + Intronic
902359769 1:15936002-15936024 CAGGAGCAGGGGCAGGAAGGGGG - Exonic
902387311 1:16083303-16083325 CTGAGGAAGGGGCTGGCAGGGGG - Intergenic
902605675 1:17567955-17567977 AAGAGGAAGGGGCTGGGTGCAGG + Intronic
902634881 1:17728697-17728719 CAGAGGCAGGGGATGGAAGTAGG - Intergenic
902654818 1:17859934-17859956 CAGAGGGAGGAGCAGGGAGGTGG + Intergenic
902678729 1:18028305-18028327 AAGAGGGATGGGCAGGAAGGAGG + Intergenic
902713262 1:18255110-18255132 CAGAGGAAGGGGCTGGAGACTGG - Intronic
902816185 1:18918011-18918033 CAGAGGAAGGGGCAGGAAGCGGG + Intronic
902921077 1:19666223-19666245 CAGCAGCAGGGGCAGGAAGGAGG - Exonic
903187026 1:21634565-21634587 CAGAGGGATGGGCAGGAAGGTGG + Intronic
903297138 1:22350940-22350962 CGGGGGAGGGGGCAGGAAGGAGG - Intergenic
903466292 1:23554665-23554687 TCGCGGACGGGGCAGGAAGCGGG + Intergenic
903474960 1:23613256-23613278 GAGAGAGTGGGGCAGGAAGCGGG + Intronic
903673435 1:25050005-25050027 CAGAGGAAAGGGTGGGAACCAGG + Intergenic
903788197 1:25875251-25875273 CAGCGGAGGGCGCAGGAAGGAGG - Intergenic
903840284 1:26234092-26234114 GATAGAAAGGGGCGGGAAGCCGG + Intergenic
903879208 1:26497297-26497319 GAAAGGAAGTGGGAGGAAGCAGG - Intergenic
903911720 1:26731615-26731637 CACAGGGAAGGGCAGGAGGCAGG - Intronic
903978854 1:27170737-27170759 CAGGGGATCGGGCAGGAAGCTGG + Intergenic
903989199 1:27253435-27253457 AAGAGGAAGGAGGAGGAAGGAGG - Intronic
904036138 1:27559776-27559798 CAGACAAATGGGCAGGAAGCAGG - Intronic
904053551 1:27655718-27655740 CAGAGGAGGAGACAGGAGGCAGG + Intergenic
904107645 1:28099350-28099372 CAAAGGCAGGGGCAGAAACCAGG - Intergenic
904485867 1:30824285-30824307 CAGAGACAGGGGCAAGAAGAAGG + Intergenic
904587108 1:31586675-31586697 CAGAGGAGGGGGAAGGGAGCTGG - Intronic
904610121 1:31721196-31721218 CTGAGGAAGGAGGAGGGAGCTGG + Intergenic
904721225 1:32510373-32510395 GACAGAAAGGGGGAGGAAGCAGG - Intronic
904900608 1:33854414-33854436 CAGAGAAAGAGGCAGTGAGCAGG + Intronic
904955858 1:34283394-34283416 CAGAGGAAGGGCCAAAAAGCAGG - Intergenic
904998625 1:34650765-34650787 CTGAGGAAGCAGCAGGAAGGAGG + Intergenic
905108350 1:35577156-35577178 AAGGGGAAGGGGCAGGAGCCGGG + Intronic
905159611 1:36020141-36020163 CTCAGGAAGGAGCAGGCAGCCGG + Intronic
906222155 1:44089301-44089323 GAAAGGAAGGAGAAGGAAGCAGG + Intergenic
906532943 1:46533758-46533780 CAGAGGCAGAGGCAGGGGGCTGG - Intergenic
906941941 1:50263092-50263114 TAGAGGAAGGGGCACAAAGGTGG + Intergenic
907250212 1:53133058-53133080 AAGATGGAGGGGCAGAAAGCAGG + Intronic
907286737 1:53385350-53385372 CAGAGGTCGGGGCAGGAAAAGGG + Intergenic
907418899 1:54333267-54333289 CAGAGGAGGCGGGAGGATGCAGG - Intronic
907481137 1:54746320-54746342 CACAGGATGGGGGAGGAAGGTGG - Intergenic
907555055 1:55336159-55336181 CAGAAGAAGGGGCAGGAGGGAGG + Intergenic
907634994 1:56125336-56125358 TAGAGGAGGGTCCAGGAAGCAGG - Intergenic
907766117 1:57412212-57412234 CAGAGGAAGGGGAAAGTAGACGG - Intronic
908316509 1:62937794-62937816 CTGAGGAAAGGGCAGGCAGCCGG + Intergenic
908333638 1:63097525-63097547 CAGATGGAGGGGCAGAAAGGTGG + Intergenic
908380432 1:63593136-63593158 CAGAGGTTGGGGTAGGAACCCGG - Intronic
910214191 1:84825758-84825780 CAGAGAAAGGCCCAGGAGGCCGG + Intronic
910459755 1:87436451-87436473 CAGAAGAAGGGCCAGGCACCCGG + Intergenic
910666923 1:89735437-89735459 TGGGGGAAGGGGCAGGAAACTGG - Intronic
911658665 1:100475533-100475555 CAGAGGAAGGTGGTGGCAGCTGG + Intronic
912098838 1:106180930-106180952 CAGAGGAAAGTGCATGAAACAGG - Intergenic
912243984 1:107941698-107941720 AAGAGGAAGAGACAGGAAGATGG - Intronic
912449749 1:109761571-109761593 CAGAGCAAGGGGCGGGAGGTGGG + Intronic
912727100 1:112068132-112068154 CTGAGGAAGGGAAAGGAAACTGG + Intergenic
912824663 1:112894699-112894721 GAGAGGCACGGGCAGGAACCGGG + Intergenic
912844203 1:113064400-113064422 CAGAGGCAGAAGCAGGAGGCAGG + Intergenic
913059199 1:115189125-115189147 CTCAGGAAGGGCTAGGAAGCAGG - Intergenic
913085877 1:115436069-115436091 CACAGGGATGGGCAGGAAGAGGG - Intergenic
913200963 1:116495156-116495178 CGGAGGAAGGAGCAGGAGGAGGG - Intergenic
913437976 1:118866740-118866762 GAGAAGAAGGGGAAGGAAGAAGG + Intergenic
914675353 1:149903929-149903951 CTGGGGCAGAGGCAGGAAGCAGG - Exonic
914745581 1:150498786-150498808 GAGAGGAAGCGGAAGCAAGCTGG - Intronic
914905697 1:151741760-151741782 CAGGGGAAGAAGCAGGCAGCTGG - Intergenic
914956436 1:152166933-152166955 CAGAGTATGGGGCAGGAAGATGG + Intergenic
915010101 1:152677327-152677349 TAGAGGAAGGGGAGGGAAGCAGG + Intergenic
916021674 1:160798128-160798150 CAGTGGAGGGGGCAGGATGTGGG - Intronic
916109105 1:161449616-161449638 CGGAGGAAAGGACAGGATGCTGG - Intergenic
916112278 1:161464407-161464429 CGGAGGAAAGGACAGGATGCTGG - Intergenic
916717273 1:167456009-167456031 CTGAGGAAGGGGGAGGGGGCGGG - Intronic
916872668 1:168933990-168934012 CAGAGGAAAGGGCGGGAGGTCGG - Intergenic
917038294 1:170773573-170773595 CAGGGGAAGGGGGAGGAAGGGGG + Intergenic
917443504 1:175087305-175087327 AAGAGAAAGGAGCAGGTAGCGGG + Intronic
917512745 1:175681760-175681782 CAGAGGGAAGGGCTGGGAGCAGG + Intronic
917663470 1:177200507-177200529 TAGAGGAATGGCCAGGAGGCTGG - Intronic
917691561 1:177475082-177475104 CAGAGCAAAGTGCAGCAAGCAGG + Intergenic
917762249 1:178174696-178174718 CAGAGGCAGAAGCAGGAAGCAGG - Intronic
918143477 1:181736899-181736921 CAGAGGCAGGGACATGAAGTGGG + Intronic
918421260 1:184366294-184366316 CAGAGGAAGAGCAAGGAAGGAGG - Intergenic
918516484 1:185369310-185369332 TAGAGGGAAGGGGAGGAAGCAGG + Intergenic
918825027 1:189313425-189313447 CGGAGTCAGGGACAGGAAGCTGG - Intergenic
919709299 1:200710375-200710397 GAGGGGAAGGGGGAGGGAGCTGG + Intergenic
919772505 1:201171378-201171400 CCCAGGGAGGGGCAGGAGGCTGG + Intronic
919775390 1:201190992-201191014 CGCAGGAAGGGGCAGGCAGTGGG + Intronic
919790720 1:201289093-201289115 CAGCAGAGGGGGCAGGAGGCTGG + Intronic
919842552 1:201619759-201619781 ATGAGGAAGAGGCAGGAGGCAGG + Intergenic
920029124 1:203026244-203026266 CAGAGGGAGGGGCAGAATGTGGG + Intergenic
920053974 1:203179676-203179698 CAGTGCAAGGGACAGGAATCTGG + Intronic
920136290 1:203771791-203771813 CAGAGGATGGGGCAGGGAGGAGG + Intronic
920215396 1:204358928-204358950 CAGTGGAAGGGGAGGGAAGCGGG - Intronic
920313433 1:205061705-205061727 AAGAGGAGGGGGCCGGAAGAAGG - Intronic
920521323 1:206629304-206629326 CAGAGGAAAGGGCAGAGAGGAGG + Intergenic
920556206 1:206906847-206906869 CAGAGGATGGTGCAGCAACCAGG - Intronic
921067608 1:211633606-211633628 CATAGGGAGGGGCAGGAGGAGGG + Intergenic
921148640 1:212382665-212382687 CATAGGCAGTGGCAGGAGGCAGG + Intronic
921257660 1:213357009-213357031 CACAGGGAGGGGCAGAAAGCAGG + Intergenic
921267797 1:213439579-213439601 GAAAGGAAGGGGCAGGAAGCAGG + Intergenic
921294727 1:213691107-213691129 CAGAGGAAGGGAAGGGAAGATGG - Intergenic
921731715 1:218586372-218586394 AAGGGGAAGAGGCATGAAGCAGG - Intergenic
922050736 1:221988333-221988355 CAGAGGATGGCTCAGGAATCAGG - Intergenic
922195215 1:223353736-223353758 CAGAGGAAGGGGCAGCAGCAGGG + Intronic
922206782 1:223455087-223455109 CACAGGAAGGGGCATGAACTTGG + Intergenic
922484459 1:225962505-225962527 CAGAAGTAGGGGCTGGAGGCGGG + Intergenic
922507713 1:226136068-226136090 AGGAGGAAGGGGCAGGAAAGAGG + Intergenic
922526483 1:226308635-226308657 CAGAGGCTGGGGCAAGAAGAAGG + Intronic
922567433 1:226610140-226610162 CTGAGGAAATGGCAGGAGGCAGG - Intergenic
922593321 1:226795413-226795435 GAGAGGGAGAGGCAGGAAGGAGG - Intergenic
922696112 1:227731869-227731891 CAGAGGAAGGCGCAGGCCGCTGG + Exonic
922773536 1:228203779-228203801 CAGAGGCTGGGGAGGGAAGCGGG + Exonic
922915676 1:229255644-229255666 GACAAGAAGGGGCAGAAAGCGGG + Intergenic
923291781 1:232552886-232552908 CACAGGCAGGTGCAGGAACCAGG + Intronic
923373896 1:233340591-233340613 CAGGGGAAGGGGGAGGCAGATGG + Intronic
923554467 1:234989909-234989931 CAGGGGAGGAGGCAGGATGCAGG + Intergenic
923681172 1:236119877-236119899 CAGAGCAAGGTCCTGGAAGCAGG + Intergenic
923732003 1:236560615-236560637 CAGTGGAAGGGGCAGGACAGTGG + Intronic
923983014 1:239347046-239347068 CAGAGGAAGGGACAGAAAGTGGG - Intergenic
923994040 1:239471549-239471571 CAGAGGCAGGATCAGGAAGAGGG + Intronic
924140012 1:241012524-241012546 CTGATGAAGGGTCAGGAAGGGGG - Intronic
924497201 1:244601998-244602020 AAGGGGAAGGGGAAGGAAGGAGG + Intronic
924919217 1:248609368-248609390 CATAGGAATGGGCACAAAGCAGG + Intergenic
1062854339 10:772273-772295 CGCCGGGAGGGGCAGGAAGCTGG - Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063173820 10:3533864-3533886 CGGAGGAAGGTGCAGGAAGGTGG - Intergenic
1063366414 10:5493614-5493636 GAGAGGAGGGGGCAGGAGGGAGG - Intergenic
1063655430 10:7983315-7983337 CAGAATAAGGGGCAAGAGGCAGG + Intronic
1063964609 10:11337484-11337506 CAGAGAAAGAGCCAAGAAGCAGG + Intergenic
1063978212 10:11433723-11433745 GACAGGAAGGGGCGGGAAGCTGG + Intergenic
1063978220 10:11433755-11433777 GACAGGAAGGGGCGGGAAGCTGG + Intergenic
1063981215 10:11453325-11453347 AAGAGGCTGGGGCAGGAGGCTGG + Intergenic
1064018494 10:11791148-11791170 CCTGGGAAGCGGCAGGAAGCTGG - Intergenic
1064240628 10:13624800-13624822 CAGATGACAGGGCAGCAAGCTGG - Intronic
1065419831 10:25530733-25530755 TAGAGGAAGTGACAGGAAACAGG + Intronic
1065492567 10:26296608-26296630 CACAGGGAGGGGCAGCAAGTGGG + Intronic
1065518759 10:26551670-26551692 CTGAGTAAGGGGTAGGAAGCAGG - Intronic
1065588268 10:27240939-27240961 CAGAGGAGGGTCCGGGAAGCGGG + Intronic
1066348530 10:34614245-34614267 CAGAGGAAGGACCAGGAACCTGG + Intronic
1066350477 10:34632347-34632369 CAGAGGATGGGGCTGGATTCTGG - Intronic
1066442153 10:35449272-35449294 CAGAGATAGGGGCAGGGAGGGGG + Intronic
1067182135 10:43996322-43996344 CAGAAGAGGGTGCAGGAAGAGGG + Intergenic
1067215793 10:44301619-44301641 GAGAGAAAGGAGCAGAAAGCTGG + Intergenic
1067370888 10:45680599-45680621 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067388889 10:45845546-45845568 CAGAGGCAGGGGATGGGAGCCGG - Intronic
1067417173 10:46111402-46111424 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067445372 10:46339004-46339026 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067502588 10:46818296-46818318 CAGAGGCAGGGGATGGGAGCCGG + Intergenic
1067510310 10:46889338-46889360 CAGAGGCATGGGCACAAAGCAGG + Intergenic
1067592001 10:47521727-47521749 CAGAGGCAGGGGATGGGAGCCGG - Intronic
1067639118 10:48029798-48029820 CAGAGGCAGGGGATGGGAGCCGG - Intergenic
1067651943 10:48162519-48162541 CAGAGGCATGGGCACAAAGCAGG - Intronic
1067755574 10:49001901-49001923 CAGAGGAATGGCCAGGGAGGGGG - Intergenic
1067839943 10:49667505-49667527 CTGAGGAAGAGGCTGGAAGCTGG + Intergenic
1067874365 10:49990497-49990519 CAGAGGCAGGGGATGGGAGCCGG + Intronic
1068737795 10:60433680-60433702 CAGAGAAGGGAGCAGGAACCAGG + Intronic
1069718518 10:70535587-70535609 AAGAGGAAGGAGAAGGAAGGAGG - Intronic
1069829038 10:71271535-71271557 CAGAGGAAGGGTCTGGAGGGAGG + Intronic
1069852801 10:71421258-71421280 CAGAGGGCTGGGCAGGGAGCAGG - Intronic
1069879126 10:71580851-71580873 CAGAGAAAGGGGTAGGAATGGGG - Intronic
1069910442 10:71755539-71755561 GAGAGGGAAGGCCAGGAAGCAGG + Intronic
1070136108 10:73695955-73695977 CAGAGGCAGGGGATGGGAGCTGG - Intronic
1070161307 10:73868258-73868280 CAGAGGAAGCAGCAGGAAGAAGG + Intronic
1070508566 10:77138989-77139011 CTGAGGAACGGGCAGGAGGCAGG - Intronic
1070596451 10:77835928-77835950 GGGAGCAAGGGGCAGGAAGAGGG + Intronic
1070781138 10:79138054-79138076 CAGCGGGAGGGGCAGGCGGCGGG + Intronic
1070845580 10:79520351-79520373 CAGAAGCAAGGACAGGAAGCTGG - Intergenic
1070928215 10:80239963-80239985 CAGAAGCAAGGACAGGAAGCTGG + Intergenic
1070961833 10:80505059-80505081 CACAGACAGGGTCAGGAAGCTGG - Intronic
1071175729 10:82924427-82924449 ATGAGGAAGGGGTAGGAAGTTGG + Intronic
1071288159 10:84167846-84167868 CAGACAAAGGAGCAGTAAGCAGG + Intergenic
1071404538 10:85317564-85317586 TAGAGAAGGGGGCAGGAAGAGGG - Intergenic
1071445964 10:85747522-85747544 AAGAGGAAGGGGCAGGAGGAAGG - Intronic
1071602794 10:86967064-86967086 TGGAGGAAGGGGGAGGGAGCAGG - Intronic
1072306866 10:94116090-94116112 GAGAGGAAGGAGCAGGAGGAAGG - Intronic
1072407564 10:95169054-95169076 CAGAAGCAGGGACAGGGAGCTGG - Intergenic
1072486771 10:95863429-95863451 GAAAGGAAGGGGTAGGAACCTGG + Intronic
1072547091 10:96448162-96448184 CAGCGGAACGAGCAGGATGCAGG - Intronic
1072873681 10:99148864-99148886 CAGAGGGAAGGGCAAGAGGCAGG + Intronic
1072899278 10:99393193-99393215 TGGAGGAAGGGGAGGGAAGCTGG - Exonic
1073371659 10:102995189-102995211 AAGAGGAAGGAGGAGGAAGAGGG - Intronic
1073397798 10:103232481-103232503 TAGTGGGAGGGACAGGAAGCCGG + Intergenic
1073444973 10:103575163-103575185 GAGAGGGAGGGGCGGGAAGTGGG - Intronic
1073448883 10:103597667-103597689 GAGAGCAAGAGGCAGGGAGCGGG - Exonic
1073452333 10:103617364-103617386 AGGAGGAGGGGACAGGAAGCAGG - Intronic
1073526424 10:104186821-104186843 CAGGTCAAGGGGCAGCAAGCAGG + Intronic
1073712660 10:106062350-106062372 CAGAGGCTGGGGCAGGGAGTGGG - Intergenic
1073970252 10:109039957-109039979 TAGAGGAAGAGGCAGAAAGGTGG + Intergenic
1074024076 10:109615712-109615734 CTCACTAAGGGGCAGGAAGCAGG + Intergenic
1074043944 10:109819765-109819787 CAGAGGAAGGGCCCTGAAGGAGG - Intergenic
1074190201 10:111128887-111128909 GGGAGGAAGGGGGAGGAAGGAGG - Intergenic
1074289598 10:112128346-112128368 CACAGGGAGGGGTAGGAAGACGG + Intergenic
1074447941 10:113535705-113535727 CAGAGGAACAGGCAGGAATGGGG + Intergenic
1074472522 10:113740525-113740547 CAGAGCAGGGTGCTGGAAGCAGG + Intergenic
1074561578 10:114539879-114539901 CAGGGGAAGGGGGAGGAGGAGGG + Intronic
1074701481 10:116096432-116096454 GAAAGGCAGAGGCAGGAAGCGGG - Intronic
1074786995 10:116849924-116849946 CAGAGAAAGTGGCAGAAAGGAGG + Exonic
1074899105 10:117801518-117801540 CAGAGGAAAGGGCAGCAGGGGGG - Intergenic
1075129444 10:119725911-119725933 CGGAGGAAAGGGCAGGAAGCGGG + Intergenic
1075222974 10:120600648-120600670 CAGAGGAAGCAGAAGCAAGCCGG - Intergenic
1075303026 10:121342270-121342292 GAGGGGAAGAGGCAGGAAGGGGG + Intergenic
1075399520 10:122150910-122150932 CAGGGGAAGGAGCATGAAGTTGG + Intronic
1075871544 10:125775005-125775027 CAGAGGCCAGGGCAGGGAGCAGG - Intronic
1075920130 10:126204529-126204551 CTGAAGAAAGGGCATGAAGCGGG - Intronic
1075936931 10:126350919-126350941 CAGGGGAAGGGGCAGGGCTCCGG - Intronic
1075957893 10:126539902-126539924 CAAAGAAAGAGGCACGAAGCTGG + Intronic
1076035576 10:127196419-127196441 CAGAGCCAGGGCCAGGAGGCGGG + Intronic
1076120792 10:127935196-127935218 CAGTGGGAGGGGCAGAGAGCGGG - Intronic
1076122195 10:127945109-127945131 CAGGGGAAGGGTGAGGAAGCTGG - Intronic
1076150094 10:128154803-128154825 CAGAGGAGGGGGCTGGGAGTAGG - Intergenic
1076385674 10:130053497-130053519 CAGAGGTAGAGGCAAGAACCAGG - Intergenic
1076475727 10:130750266-130750288 TAAAGGAAGGGGCAGGCAGAGGG - Intergenic
1076523310 10:131094641-131094663 CAGGGGAGAGGGCAGGAAGGAGG - Intronic
1076564094 10:131386487-131386509 CAGAGGGAGGAGCAGGGAGAGGG + Intergenic
1076826586 10:132972548-132972570 AAGAGGGAGGGCCAGGGAGCAGG - Intergenic
1076846590 10:133072248-133072270 CTGAGGAAGGGGCAGAAGCCTGG + Intronic
1076980798 11:203695-203717 CCGAGGAGGGGGAAGCAAGCTGG + Exonic
1077068181 11:654117-654139 CAGAGGCAGGTGCAGGCAGGAGG + Intronic
1077243613 11:1524977-1524999 CTGGGGAAGGGGAAGGAAGGTGG + Intergenic
1077407612 11:2389624-2389646 CAGCAGCTGGGGCAGGAAGCAGG - Intronic
1077483556 11:2827836-2827858 AAGAGGAAGGGGCGGGCAGAAGG + Intronic
1077705425 11:4480707-4480729 AAGATGAAGGGGAAGCAAGCAGG - Intergenic
1078089584 11:8256457-8256479 CAGGGGAAGGGACAGGAGGGAGG + Intronic
1078241408 11:9534013-9534035 CAGAGGAAAGGGCAAGCAGGAGG - Intergenic
1078454910 11:11467428-11467450 CAGAGGATGTTGCTGGAAGCTGG - Intronic
1078496386 11:11821768-11821790 CATAGGATGGTGCAGGAAGAAGG - Intergenic
1078516501 11:12027225-12027247 CTCTGGAAGGGGCAGGAACCAGG - Intergenic
1078575056 11:12494302-12494324 ATGAGAAAGGGGAAGGAAGCTGG - Intronic
1078694905 11:13620999-13621021 AGGATGAAGGGGTAGGAAGCTGG - Intergenic
1078757869 11:14228431-14228453 GGGAGGCAGGGGAAGGAAGCAGG + Intronic
1079271169 11:18987297-18987319 CAGAAGCCGGGGCAGGAAGGGGG - Intergenic
1079493106 11:21011370-21011392 GAAAGGAAAGGGGAGGAAGCAGG + Intronic
1079927887 11:26519075-26519097 CATAGGATGGGGCAGGATGAAGG - Intronic
1080338981 11:31234707-31234729 CGGAGGAGGGGGCAGGAGGCAGG + Intronic
1080503115 11:32888528-32888550 GAGAGGCGGGGGCAGGAACCGGG - Intergenic
1080849876 11:36058992-36059014 CAGAGGGAGGTAAAGGAAGCAGG - Intronic
1080862956 11:36166104-36166126 CAGCGGAAAGAGCAGGAACCAGG - Intronic
1081026226 11:38018862-38018884 GAGCTGAAGGGGGAGGAAGCAGG + Intergenic
1081315173 11:41622877-41622899 GAGAGGCACGGGCAGGAACCGGG + Intergenic
1081539093 11:44017161-44017183 CAGAGGAAGGGACAGCAAGGTGG + Intergenic
1081573944 11:44308041-44308063 AAGAGGAAGGTGGAGGAAGTGGG + Intronic
1081580320 11:44347302-44347324 CCAAGGCAGGGGCACGAAGCTGG + Intergenic
1081661833 11:44893154-44893176 CAGAGGAAAGGGCTGGTGGCAGG + Intronic
1081708897 11:45204594-45204616 CAGGGGGAGGGGGAGGGAGCAGG + Intronic
1081744573 11:45463914-45463936 CAGAGGAAGGGGCCAAGAGCTGG + Intergenic
1081814273 11:45929783-45929805 TAAAGTGAGGGGCAGGAAGCTGG - Intronic
1082190095 11:49232584-49232606 TGAAGGAAGGGGAAGGAAGCAGG - Intergenic
1083106730 11:60365466-60365488 CAGAGTCAGGGGCAGGAATGAGG - Intronic
1083173975 11:60938089-60938111 CAGGGTCAGGGGCAGCAAGCAGG - Intronic
1083293252 11:61701378-61701400 CAGAGGGAGAGGCGGGCAGCAGG - Intronic
1083303123 11:61749088-61749110 CAGAGGCTGGGGCAGGAAGGTGG - Intergenic
1083605440 11:63975911-63975933 TAAAGGAAGGGACAGGAAGCAGG - Intronic
1083656151 11:64230658-64230680 CAGAGGAAGGGGCAGGTCCAAGG + Exonic
1083940306 11:65891874-65891896 AAGACAATGGGGCAGGAAGCAGG + Intergenic
1084491258 11:69479856-69479878 CAGAGGAGGCGGCAGGAAGGTGG - Intergenic
1084495453 11:69500760-69500782 CAGAGGCAGGGCCAGGAGGGTGG - Intergenic
1084548244 11:69825234-69825256 CAGAGCCAGAGGCAGGAAGCTGG - Intergenic
1084587067 11:70068519-70068541 CAGTGGAAGGGGCTGGGAGTGGG + Intergenic
1084768491 11:71327471-71327493 CAGAGCAAGGTGCTGGGAGCCGG - Intergenic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085177665 11:74505030-74505052 CTGAGGGTGGGACAGGAAGCAGG + Intronic
1085265642 11:75236435-75236457 CAGAGGGATGGGAAGGCAGCAGG + Intergenic
1085311012 11:75516622-75516644 TGAAGGAAGGGGCAGGAGGCAGG + Intronic
1085318798 11:75562085-75562107 CAGAGGGAGGGGCCGGGGGCCGG + Intronic
1085405541 11:76259666-76259688 CAGAGGAAGAGGAAGGAAGAAGG + Intergenic
1085708999 11:78812298-78812320 CAGAGCACGGGGCAGGAGGCTGG + Exonic
1085941092 11:81207596-81207618 GAGAGGCAGGGGCGGGAACCAGG + Intergenic
1086676034 11:89608348-89608370 TGAAGGAAGGGGAAGGAAGCAGG + Intergenic
1088015881 11:105059304-105059326 CAGAGGTTGTGGCAGGAAGGAGG - Intronic
1088084910 11:105965807-105965829 CAGAGGAAGGGGCTGCAGGATGG + Intronic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1088814209 11:113410403-113410425 CAGAGGAAGGTCAAGGAAGGCGG + Exonic
1089304394 11:117517540-117517562 CAGAGGAGAGGGCAGGAGGGTGG + Intronic
1089589239 11:119529963-119529985 CAGAGCAGGGGTCAGGAAGCTGG - Intergenic
1089645296 11:119874878-119874900 CAGCAGAAGGGGCCGGAAGCTGG - Intergenic
1089668083 11:120032962-120032984 GAGGGGGAGGGTCAGGAAGCGGG - Intergenic
1089879596 11:121760932-121760954 CAGAGCATGGGGCAGGAACAAGG + Intergenic
1090480034 11:127059869-127059891 CAGAGGAAGGAGCAGGGGACAGG + Intergenic
1090640457 11:128725294-128725316 CAGGAGAAAGGGGAGGAAGCGGG - Intronic
1090652487 11:128819561-128819583 CAGTGGGAGGGGGAGGAAGAGGG + Intergenic
1090664991 11:128909016-128909038 CACATGAAGGAGCAGGAAGCAGG + Intronic
1090803554 11:130189003-130189025 CAGTGTGTGGGGCAGGAAGCGGG + Intronic
1090880410 11:130827721-130827743 CAGAGAAACAGGCAGGAAGCAGG - Intergenic
1091319986 11:134642524-134642546 CTGTGGAAGGTGCAGGAAGAGGG - Intergenic
1091410392 12:235280-235302 AGGAGGCAGGGGCAGGAGGCAGG + Intronic
1091647119 12:2282288-2282310 AAGAAGAAGAGGGAGGAAGCAGG - Intronic
1091751852 12:3027260-3027282 CAAAGAAAGGAGCAGGAGGCTGG - Intronic
1091778975 12:3201925-3201947 CAGTGGACCGGGCAGGGAGCTGG + Intronic
1092125935 12:6075115-6075137 CGGAGGCAGGGGCAGGACACGGG + Intronic
1092201101 12:6583385-6583407 CAGAGGGAGGGCCAGGACTCAGG + Intronic
1092778155 12:11961979-11962001 CACAGAGAGGGCCAGGAAGCAGG + Intergenic
1093269138 12:17037167-17037189 AAGAGGAAGGGGAAAGAAGCAGG - Intergenic
1093566456 12:20610889-20610911 CAGGGGAAGGGTCAGGAAATGGG + Intronic
1093778012 12:23099878-23099900 CAGACCAAGAAGCAGGAAGCAGG + Intergenic
1093878545 12:24377636-24377658 CAGTGGAAGGAGCACGAGGCTGG - Intergenic
1094260358 12:28490143-28490165 ATGAGAAAGGGGCAGGAAGATGG - Intronic
1094487010 12:30933478-30933500 GAGAGGAAGGAGCTGGAAGGGGG - Intronic
1094491093 12:30961176-30961198 CAGCAGAAGAGGCAGGAAGAGGG - Intronic
1095304124 12:40620676-40620698 GAGAGGCACGGGCAGGAACCGGG + Intergenic
1095800404 12:46266454-46266476 CAGCGGAAGGAACAGGAAGAAGG - Intronic
1095810984 12:46372911-46372933 CAGAGGGAGGGGCAGGGAGGCGG - Intergenic
1095940022 12:47720600-47720622 CAGAGGCAGGGTCAGGAATTTGG - Intronic
1096192750 12:49631052-49631074 CAGATGAAGGGGCAGAAGGCAGG - Intronic
1096204003 12:49706763-49706785 CAGCAGAAGGGGGAGGAAGAAGG + Intronic
1096212982 12:49780574-49780596 CAAAGGAGGGGGAAAGAAGCAGG - Intergenic
1096228369 12:49883492-49883514 CAGGGGAAGGGGCAGGAGCTTGG + Intronic
1096334105 12:50740039-50740061 CAGAGGCCTGGCCAGGAAGCAGG - Intronic
1096489998 12:52007927-52007949 CAGAGGAAGAGGCTGGCAGAGGG - Intronic
1096510106 12:52123025-52123047 CAGAAGCAGCGGCAGGAAGATGG - Intergenic
1096557243 12:52410920-52410942 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1096572924 12:52534009-52534031 AAGAGAAAGGGGCAGGCTGCAGG + Intergenic
1096835890 12:54351050-54351072 CAGAGGACAGGGCAGTAAGAAGG - Exonic
1096883205 12:54689490-54689512 CAGAGGAAGAGGTAGAAAGAAGG - Intergenic
1097241350 12:57577644-57577666 TAGAGGAAGAGGCAGGAGGAAGG + Intronic
1097856529 12:64469365-64469387 CGGAGAAAGGAGCAGGAAGGGGG - Intronic
1097925291 12:65121013-65121035 CAGGGGAAGGCGCTGGAGGCGGG + Intronic
1098188328 12:67922115-67922137 CAGTGAAAGGGCCTGGAAGCTGG + Intergenic
1098270180 12:68762388-68762410 CAGAGGAAGGAGGAGGAGGCGGG + Intronic
1100142304 12:91633945-91633967 GAGAGGCACGGGCAGGAACCGGG + Intergenic
1100456692 12:94758584-94758606 CAGGGGAAAGGGTAGGAAGGGGG - Intergenic
1100700240 12:97139656-97139678 AAGATGAAGGGGAAGAAAGCAGG - Intergenic
1100772926 12:97943177-97943199 CAAAGGAAGTGGAGGGAAGCTGG + Intergenic
1101645855 12:106630372-106630394 CAGAGGAGGCGAGAGGAAGCAGG + Intronic
1101729637 12:107416365-107416387 CAGAGGAAGGACCAGCTAGCTGG - Intronic
1101842628 12:108339360-108339382 AGGAGGGAGGGGCAGGAAACTGG + Intergenic
1102178866 12:110896606-110896628 CTGAGGGAGAGGCAGGAATCAGG + Intronic
1102222295 12:111202674-111202696 CATTGGAGGGGGCAGGAGGCGGG + Intronic
1102428385 12:112862543-112862565 GATTGGAGGGGGCAGGAAGCAGG - Intronic
1102484520 12:113246863-113246885 CAGAGGAAGGGGCTGGACTGGGG + Intronic
1102492332 12:113296814-113296836 CGGAGGAAGGGGCATGAGGCAGG + Exonic
1102522155 12:113485163-113485185 AAGAGGAGGGGACAGGAAGAGGG - Intergenic
1102606429 12:114071228-114071250 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
1102679816 12:114683867-114683889 CAGAGGAAGGAGGAGGAGGGCGG - Intronic
1102691581 12:114765596-114765618 CTGAGGAAGGTTCTGGAAGCAGG + Intergenic
1102819340 12:115894685-115894707 CAGAGCAAGGGGGAGGCAGCAGG + Intergenic
1102928343 12:116843616-116843638 CAGAGGAAGGGGGAGGAAGAAGG - Intronic
1103304224 12:119951703-119951725 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304276 12:119951843-119951865 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304299 12:119951907-119951929 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103304322 12:119951971-119951993 AATAGGAAGGGGAAGGAAGAAGG + Intergenic
1103564048 12:121806568-121806590 GAGGGGAAGGGGCAGCAAGGAGG - Intronic
1103778481 12:123383839-123383861 CAGCGGGAGGGGGAGGAATCTGG + Exonic
1104416665 12:128601461-128601483 CAGAGAAAGGAGGAGGAAGATGG + Intronic
1104521507 12:129480138-129480160 CAGAGGAGGGTCCAGGCAGCGGG + Intronic
1104602775 12:130164126-130164148 CAGGGGAATGAGCACGAAGCCGG - Exonic
1104644034 12:130484520-130484542 CAGGGGAAGGAGCAGATAGCAGG - Intronic
1104674029 12:130700574-130700596 CAGAGGTGGGGGCAGGGGGCTGG + Intronic
1104757998 12:131280843-131280865 AAGAGGAGGGAGCTGGAAGCTGG - Intergenic
1104771885 12:131368897-131368919 CAGAGGAAGGGGCATGGAGGAGG + Intergenic
1104876629 12:132039408-132039430 GGGAGCAAGGGGCAGGCAGCAGG + Intronic
1105683351 13:22752285-22752307 CAGAGGGAGGGTCAGCAAGAGGG - Intergenic
1106027939 13:25973113-25973135 CAAAGGCAGGGGCAGCAACCGGG - Intronic
1106278692 13:28242110-28242132 TAGAGGAATGTGAAGGAAGCTGG - Intronic
1106634244 13:31510115-31510137 CAGAGAGAGGGACAGCAAGCTGG + Intergenic
1106707831 13:32300586-32300608 ATGAATAAGGGGCAGGAAGCAGG - Intergenic
1106879405 13:34112933-34112955 CAGTGGGATGGGTAGGAAGCTGG - Intergenic
1107114216 13:36729234-36729256 CAGGGAAAGTGGGAGGAAGCTGG - Intergenic
1107968060 13:45615189-45615211 GAGAGGTAGGGGAAGGAAACAGG + Intronic
1108343424 13:49519958-49519980 AAGAGGAAGGGAGATGAAGCTGG + Intronic
1109124955 13:58505780-58505802 GAGAGGCATGGGCAGGAACCGGG - Intergenic
1109181539 13:59219974-59219996 GGGAGGAAGGGGGAGGAAGGGGG + Intergenic
1110397766 13:75051651-75051673 TAGAGGAAAGGGGAGCAAGCTGG + Intergenic
1110830582 13:80026039-80026061 CAGAGGAAGGGGCATGCATCAGG - Intergenic
1111425228 13:88071564-88071586 AAGAAGGAGGGGCAGGAAACAGG - Intergenic
1111908828 13:94287411-94287433 CAGAGGAGGGGACAGGTAGTAGG + Intronic
1112086026 13:96033625-96033647 CAGAGAAGAGGCCAGGAAGCAGG - Intronic
1112350183 13:98626441-98626463 GAGAGGAGAGGGAAGGAAGCTGG + Intergenic
1112563881 13:100535957-100535979 CAGAGGACGGGACAGGAATGAGG - Intronic
1113084501 13:106554448-106554470 GAGAGGAAGGGGAAGGAAAAAGG + Intronic
1113313632 13:109156668-109156690 CTGGGGAAAGGCCAGGAAGCAGG - Intronic
1113325445 13:109277201-109277223 CAGTGGAATGGGCAGAAAGGGGG - Intergenic
1113636605 13:111923293-111923315 CTGAGGAAGGGCCAGGGTGCCGG + Intergenic
1113923287 13:113926595-113926617 CAGAGGATGGGGAAGGAATGAGG + Intergenic
1114614933 14:24063272-24063294 CAGAGGAATGGGGAGAAAGCAGG - Intronic
1114617627 14:24076637-24076659 GGGTGGAAGGGACAGGAAGCTGG - Intronic
1115167461 14:30464873-30464895 GAGAAGGAGGGGCAGGAGGCAGG + Intergenic
1115421386 14:33199099-33199121 GAGAGGCACGGGCAGGAACCAGG - Intronic
1115591859 14:34873686-34873708 AAGAGGAAGGGGGAAGAAGCAGG - Intronic
1115620117 14:35132830-35132852 CAAAGGAAAGGGAAGGAAGAAGG + Intronic
1115949775 14:38708070-38708092 AAGAGGGAGGGGATGGAAGCTGG - Intergenic
1116336563 14:43665300-43665322 TAGCTGAAGGGGAAGGAAGCTGG + Intergenic
1117244432 14:53870166-53870188 CAGAGGAAGCAGGAGGAAGTGGG + Intergenic
1117748248 14:58893204-58893226 CAGAAAAAGGGGCAGGAGACAGG + Intergenic
1117763843 14:59059708-59059730 CAGGGGCAGGGGCAGGGGGCAGG + Intergenic
1117763853 14:59059727-59059749 CAGGGGCAGGGGCAGGGGGCAGG + Intergenic
1118312904 14:64706002-64706024 CTGGGGATGGGGCAGGAAGTTGG + Intronic
1118443619 14:65833057-65833079 CTAAGGAAGCTGCAGGAAGCTGG + Intergenic
1118610765 14:67537823-67537845 CAGAGGCAGGGGCTGGGAGTAGG - Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1119322710 14:73741096-73741118 CAGTGGAAGGGGCAGGGGTCAGG - Intronic
1119337653 14:73847765-73847787 CGGAGGAAGAGGAAGAAAGCAGG - Intergenic
1119443776 14:74647303-74647325 CAGAGGAAGGAGAAGGGAGTCGG - Intergenic
1119679743 14:76583841-76583863 CAAGGGAAGGGCCAGGAAGGAGG - Intergenic
1119719319 14:76880535-76880557 CAGAGGAAATGGCACGGAGCTGG - Intergenic
1119785978 14:77314670-77314692 CAGAGGACAGGGCAGTAACCAGG - Intronic
1119900998 14:78259705-78259727 CAGAAGGAAGGGCAGCAAGCAGG - Intronic
1120175329 14:81287799-81287821 CAGAGGAAGAGGCCAGAAGTAGG - Intronic
1120998475 14:90434692-90434714 CAGAGGAAGGGGCAGCAGGGCGG + Intergenic
1121020709 14:90578563-90578585 CAGAGGTTGGGGCAGGGACCAGG - Intronic
1121093901 14:91202591-91202613 CAGCCGGAGGGACAGGAAGCTGG - Intronic
1121107944 14:91293220-91293242 CAGGTGAGGGGGCAGGAAGGTGG - Intronic
1121107989 14:91293366-91293388 CAGGCGAGGGGGCAGGAAGGTGG - Intronic
1121107999 14:91293396-91293418 CAGGTGAGGGGGCAGGAAGGTGG - Intronic
1121246312 14:92463318-92463340 AAGAGGAAAGGACAGGAAGGCGG - Intronic
1121533834 14:94677562-94677584 GAGAGGCAGGAGGAGGAAGCAGG + Intergenic
1121593262 14:95137156-95137178 AAGAGGAAGGGGAAGGAAAAGGG + Intronic
1121695510 14:95908927-95908949 CAGTGGAAGTGGCAGGTAGGCGG + Intergenic
1122270137 14:100565305-100565327 CAAAGGCAGGGGCATGAAGGTGG + Intronic
1122283274 14:100636741-100636763 CAGGGGAAGGAGCAGGGAGTGGG - Intergenic
1122294915 14:100699993-100700015 CAGAGGCAGGGGTTGGAAGGAGG + Intergenic
1122353803 14:101111951-101111973 AGGAGGAAGGGGAAGGAAGGAGG - Intergenic
1122779585 14:104138158-104138180 CCGAGGAAGGGGCGGGACCCCGG - Intergenic
1122799702 14:104223414-104223436 CAGAGAAAGGAGGAGGCAGCTGG - Intergenic
1122863076 14:104591297-104591319 CTGAAGGAGGGGCAGGAGGCAGG - Intronic
1122948007 14:105022002-105022024 CCGAGGCAGGGGCAGGAGGCAGG + Intergenic
1122971770 14:105155111-105155133 CAGAGGAAGGGGCTGCTGGCAGG - Intronic
1123033686 14:105463135-105463157 AGCAGGAAGGGGCAGGAGGCAGG - Intronic
1123039210 14:105483532-105483554 GAGAGGGAGGGGCAGGGAGGTGG + Intergenic
1123109948 14:105862224-105862246 CACAGCAGGTGGCAGGAAGCAGG - Intergenic
1202856922 14_GL000225v1_random:57772-57794 AAGAGGAAGGGGCAGGGCGAAGG - Intergenic
1123453942 15:20399556-20399578 CAGAGGATGGGGCTGGGAGGAGG - Intergenic
1124083788 15:26527093-26527115 TAATGGATGGGGCAGGAAGCAGG + Intergenic
1124112691 15:26806821-26806843 CAGAGCATGGGGCAGGAGGTGGG + Intronic
1124393473 15:29280490-29280512 AAGAGGAAGAGGCAGGATACAGG + Intronic
1124521482 15:30409512-30409534 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124537179 15:30556707-30556729 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1124567129 15:30826625-30826647 CAGTGGGAGGGGCGGGAATCAGG - Intergenic
1124614882 15:31234312-31234334 CTGAGGAAGGGGCAGAAGGGTGG + Intergenic
1124761474 15:32450884-32450906 CAGGGGATGGGGCAGGTGGCTGG + Intronic
1124777158 15:32598184-32598206 CAGGGGATGGGGCAGGTGGCTGG - Intronic
1125385940 15:39136504-39136526 CAGGGGAAGGGGGAGCATGCTGG - Intergenic
1125456861 15:39868809-39868831 CATACGAAGGGGCAGGAGCCAGG + Intronic
1125549913 15:40537466-40537488 CAGAGCAAGGGGTAGGAGACAGG - Intronic
1126113283 15:45187744-45187766 CGGCGGAGGGGGCAGCAAGCCGG - Intronic
1126644361 15:50860034-50860056 CAGGGGAGGTGGCAGAAAGCAGG - Intergenic
1126695701 15:51323669-51323691 CAGAGGAGGAGGCAGGGTGCTGG - Intronic
1126753028 15:51896716-51896738 CATAGGAAGGAGGGGGAAGCTGG - Intronic
1127001457 15:54512596-54512618 GAGAGGGAGGGTCATGAAGCAGG + Intronic
1127211546 15:56779627-56779649 GAGAGGCACGGGCAGGAACCAGG + Intronic
1127907116 15:63384119-63384141 GAGAAGAAGGGGCAGGAGACAGG - Intergenic
1128083466 15:64870467-64870489 CAGAGGAGGAGGAAGGGAGCTGG - Intronic
1128095821 15:64954599-64954621 AAGAGGAAGGAGGAGGAAGAAGG - Intronic
1128156286 15:65393945-65393967 CAGGGGAAGGGTGAGGAAGGAGG - Intronic
1128157663 15:65401997-65402019 GAGAGAAAGGGGCAGGGAGCAGG + Intronic
1128244940 15:66126674-66126696 CAGAGACAGTAGCAGGAAGCAGG + Intronic
1128389252 15:67172203-67172225 CCGAGGAAGGGGCAGTAGGGAGG - Intronic
1128754291 15:70170872-70170894 GAGAGGAAAGTGCAGGGAGCTGG + Intergenic
1128997400 15:72306983-72307005 GAGAGGAAGGGTAAGGAAGCGGG + Intronic
1129379549 15:75156473-75156495 TAGAGGAACTGGGAGGAAGCAGG + Intergenic
1129682154 15:77663970-77663992 CAGAGGCTGGGGCAGGACCCGGG + Intronic
1130297453 15:82657140-82657162 CAAAGAGAGAGGCAGGAAGCAGG - Intergenic
1130553266 15:84905424-84905446 CAGAGGATGGGGCTGGAGCCAGG - Intronic
1130881778 15:88061641-88061663 CAGATGAAGAAGCAGGAAGTGGG - Intronic
1130904035 15:88227529-88227551 CAGGTGAAGGGGCAGCAAGAAGG + Intronic
1131025540 15:89138192-89138214 CACAGGAAAGGTAAGGAAGCCGG - Intronic
1131059061 15:89393235-89393257 GAGAAGAAGGGACAGGAAGGAGG - Intergenic
1131251945 15:90836783-90836805 CAGTGGACGGGGCAGGAGTCAGG - Intergenic
1131429761 15:92377421-92377443 GAGAGGAAGGGAGAGGCAGCAGG - Intergenic
1131793335 15:95988396-95988418 AAGAGGGAGGGGAAGGAAGAGGG + Intergenic
1132688043 16:1170446-1170468 CAGAGGCAGGGGAGGGGAGCGGG + Intronic
1132767623 16:1542419-1542441 TTGAGGAAGGGGCAGGACCCAGG - Intronic
1132783865 16:1643579-1643601 CCGAGGGAAGGGCAAGAAGCAGG + Intronic
1132890105 16:2199606-2199628 CAGAGGAAGGGGCTGCGGGCTGG - Intergenic
1133280194 16:4660778-4660800 CAGTGGAGTGGGCAGGAAACAGG + Intronic
1133344034 16:5058442-5058464 CAGGGGAAGGGGAAGGAAAAAGG - Intronic
1133389939 16:5402126-5402148 AAGAGGAAGGGGCAGAGACCAGG + Intergenic
1133897610 16:9944414-9944436 CAGAGGAAGGGGGAGGGAGGTGG - Intronic
1134008808 16:10836021-10836043 CAGAGTAATGGGCAAGAGGCTGG - Intergenic
1134092488 16:11399063-11399085 CAGAGCTTGGGGCAGGAACCAGG - Intronic
1134167472 16:11941859-11941881 CAGAAGCAGGGACAGGGAGCTGG - Intronic
1134224207 16:12379098-12379120 GAAAAGAAGGGGCAGGAAACAGG - Intronic
1134261048 16:12651033-12651055 GAGAAGGAGGGGCAGGAAGGGGG + Intergenic
1134279320 16:12803722-12803744 CAGAGCCAGGGGCAGGACCCTGG - Exonic
1134469761 16:14513594-14513616 CAGGGGAGGGAGCAGGAAGCTGG - Intronic
1134493227 16:14711853-14711875 CAGAAGCAGGGACAGGGAGCTGG + Intronic
1134498608 16:14750977-14750999 CAGAAGCAGGGACAGGGAGCTGG + Intronic
1134525162 16:14937607-14937629 CAGAAGCAGGGACAGGGAGCTGG + Intronic
1134547732 16:15123312-15123334 CAGAAGCAGGGACAGGGAGCTGG - Intronic
1134581966 16:15378108-15378130 CAGAAGCAGGGACAGGGAGCTGG - Intronic
1134656914 16:15954353-15954375 GAGAGGAAGGGTCTGGAAGGAGG - Intronic
1134712750 16:16336094-16336116 CAGAAGCAGGGACAGGGAGCTGG + Intergenic
1134720614 16:16379409-16379431 CAGAAGCAGGGACAGGGAGCTGG + Intronic
1134777381 16:16864975-16864997 CAGGGGAAGGGGTAGGGAGGAGG - Intergenic
1134826575 16:17289330-17289352 CAGAGAAAGGGGAAAAAAGCTGG - Intronic
1134946813 16:18332476-18332498 CAGAAGCAGGGACAGGGAGCTGG - Intronic
1134954077 16:18372599-18372621 CAGAAGCAGGGACAGGGAGCTGG - Intergenic
1135312902 16:21419511-21419533 CAGAAGCAGGGACAGGGAGCTGG - Intronic
1135365825 16:21851791-21851813 CAGAAGCAGGGACAGGGAGCTGG - Intronic
1135445989 16:22519371-22519393 CAGAAGCAGGGACAGGGAGCTGG + Intronic
1135544988 16:23359596-23359618 CAGAGAGAGAGGGAGGAAGCAGG - Intronic
1135934963 16:26771757-26771779 CAGAGCAAGGAGCAGGATGGAGG - Intergenic
1135938051 16:26797764-26797786 AAGAGGCAGAGGCAGGAAGCTGG + Intergenic
1136152058 16:28357242-28357264 CAGAAGCAGGGACAGGGAGCTGG - Intronic
1136168311 16:28471110-28471132 CAGAAGCAGGGACAGGGAGCTGG - Exonic
1136194690 16:28643941-28643963 CAGAAGCAGGGACAGGGAGCTGG + Intronic
1136211022 16:28758040-28758062 CAGAAGCAGGGACAGGGAGCTGG + Exonic
1136255743 16:29037998-29038020 CAGAAGCAGGGACAGGGAGCTGG + Intergenic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136287825 16:29254582-29254604 CACAGGAAGAGAGAGGAAGCGGG + Intergenic
1136309567 16:29398238-29398260 CAGAAGCAGGGACAGGGAGCTGG - Intronic
1136323015 16:29500019-29500041 CAGAAGCAGGGACAGGGAGCTGG - Intronic
1136399736 16:30010885-30010907 CAGAGGCAGGTGCAGGGGGCTGG - Exonic
1136437699 16:30239987-30240009 CAGAAGCAGGGACAGGGAGCTGG - Intronic
1137444770 16:48525017-48525039 CAGAGGGAGGGGCAGGAGTGGGG - Intergenic
1137811785 16:51359465-51359487 GAGAGGAAGGGTGAGGAAGCAGG + Intergenic
1137944519 16:52720975-52720997 CAGAGGAAGGGGTTAGGAGCAGG - Intergenic
1137977809 16:53045906-53045928 CAGAGGCAGGGGCAGAAAGGGGG - Intergenic
1138106457 16:54289534-54289556 GCGAGGAGGGGGCAGGAAGCGGG - Intergenic
1138554892 16:57765310-57765332 CAGAGGAAGGAGCAGGACCCTGG + Intronic
1138608658 16:58105730-58105752 CAGAGGAGGGGCCAGGCTGCTGG - Intergenic
1139008323 16:62601126-62601148 GAAAGGAAGGGGAAGAAAGCAGG - Intergenic
1139205914 16:65028275-65028297 CAGAGGCAGGGGCAGACACCAGG - Intronic
1139351071 16:66336153-66336175 GAGAAGAAGGAGTAGGAAGCAGG - Intergenic
1139424972 16:66873817-66873839 GAGAGGAAGGGGGAGGAGGAGGG - Intergenic
1139636942 16:68263865-68263887 CAGAGGGAGGGGAAGGGGGCAGG + Intergenic
1139688574 16:68623610-68623632 CGGAGGTTGGGGCAGGAAGATGG - Intergenic
1139825310 16:69752631-69752653 CAGAGGAAGGAGCAGAAAGTTGG + Intronic
1139857251 16:69990618-69990640 CAGAAGCAGGGACAGGGAGCTGG - Intergenic
1140129768 16:72150247-72150269 GAAAGGAAGAGGGAGGAAGCAGG + Intronic
1140221446 16:73047528-73047550 CAGAGGGAAGGGAAGGAAGGAGG + Intronic
1140365421 16:74377303-74377325 CAGAAGCAGGGACAGGGAGCTGG + Intergenic
1140481126 16:75263466-75263488 CAGAGGAAGGGGCACTGAGCAGG + Intronic
1141188543 16:81806883-81806905 CAGAGTTATGGGGAGGAAGCAGG + Intronic
1141440936 16:84029179-84029201 CAGAGGAAGGGACAGGTCCCGGG + Intronic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142093476 16:88227285-88227307 CACAGGAAGAGAGAGGAAGCGGG + Intergenic
1142251394 16:88993625-88993647 GAGAGGAGGGGGGAGGAAGGAGG - Intergenic
1142358890 16:89616977-89616999 CAGAGAATGGGGCGGGAGGCTGG + Intronic
1142368010 16:89660438-89660460 CAGAGGGTGGGGGAGGAAGGTGG + Intronic
1142486178 17:248894-248916 GAGCGGAAGGGACAGGAAGGAGG - Intronic
1142607610 17:1090766-1090788 CAGAGAACAGGGCAGGAAGGAGG + Intronic
1142610439 17:1106862-1106884 CAGAGCAAGGGGCAGGTACAGGG - Intronic
1142889898 17:2936469-2936491 GAGAGGAAGAGGGAGGAAGAAGG - Intronic
1142953077 17:3500136-3500158 GTGAGGAAGCTGCAGGAAGCTGG + Exonic
1142961857 17:3556499-3556521 CATAGGTGGGGGCAGGAAGACGG + Intronic
1143017873 17:3900988-3901010 CAGAGAAGGGGACAGGGAGCTGG + Intronic
1143321693 17:6072527-6072549 CAGAGAAAGAGTCAGGGAGCTGG - Intronic
1143366555 17:6412535-6412557 CAGAGCAGGGTGCAGGAAGGAGG + Intronic
1143382821 17:6507120-6507142 CAGGGGAAGGAGAAGAAAGCTGG + Intronic
1143476751 17:7207524-7207546 CGGAGGTAGGGGGAGGAGGCGGG + Intronic
1143501414 17:7341706-7341728 GAGAGGAATGGGCAGGAATTGGG + Intronic
1143586127 17:7851422-7851444 CAGAGGGAGGGGAAGGAAGCAGG - Intronic
1143690261 17:8556601-8556623 CAGGGGCAGGGGCAGGAGGAGGG + Intronic
1143766818 17:9143282-9143304 CAGAAGCATGGCCAGGAAGCTGG + Intronic
1143780043 17:9224588-9224610 CTGTGGAAGGGGCGGGAGGCTGG - Intronic
1143867473 17:9934541-9934563 CCCAGGAAGGTGCCGGAAGCAGG + Intronic
1143867905 17:9937465-9937487 CTGAGATAGGGGCAGGAAGGGGG - Intronic
1143948416 17:10614434-10614456 GAGTGGAAGGGGCACGATGCAGG + Intergenic
1144221626 17:13105088-13105110 AAGAGGGAGGGGCAGGACGAAGG - Intergenic
1144587030 17:16493035-16493057 CAGAGGCACGGGGAGGAAGGTGG - Intergenic
1144650541 17:17004357-17004379 CAGGGGCAGGGGCAGGAGGACGG - Intergenic
1144677010 17:17168251-17168273 CCGGGGCAGGGGCAGGAAGGAGG - Intronic
1145010968 17:19367744-19367766 CAGAGGAAGGGGCATTTATCGGG - Intronic
1145268032 17:21389832-21389854 CACAGGGAGGGCTAGGAAGCAGG - Intronic
1145901948 17:28495297-28495319 GACTGGAAGGGGCAGGAAGAGGG + Intronic
1146178115 17:30679608-30679630 CAGAGGAGGGGGGAGGACGGGGG + Intergenic
1146273311 17:31498433-31498455 CAGAAGATGGGGCAGGGAGGAGG + Intronic
1146299436 17:31676707-31676729 AGCAGAAAGGGGCAGGAAGCTGG + Intergenic
1146415250 17:32625864-32625886 CAAAGGGAGGGGCAGGTAGCAGG + Intronic
1146926689 17:36750499-36750521 CTGAGGACGGGGCATGAGGCAGG - Intergenic
1147138936 17:38450972-38450994 CTGATGCAGGGGGAGGAAGCTGG + Intronic
1147217512 17:38909221-38909243 ATGAGGATGGGGGAGGAAGCGGG - Intronic
1147258373 17:39195325-39195347 CCGAGGAAGGGAGAGGCAGCCGG + Intronic
1147584704 17:41647635-41647657 CAGAGGCAGGGACAGGAAGCAGG + Intergenic
1147599782 17:41738666-41738688 CAGGGGAGGGGGCAGGAGGAGGG - Intergenic
1147632392 17:41940439-41940461 AAGAGGAAAGGGCAGGAGGCAGG - Intronic
1147684343 17:42277613-42277635 CAGAGAAGGAAGCAGGAAGCAGG + Intergenic
1147988847 17:44321348-44321370 CAGAGGTTGGGGCTGGGAGCTGG + Intronic
1148150027 17:45391440-45391462 CAGGGGAAAGGGAAGGAGGCAGG + Intergenic
1148359714 17:47001641-47001663 AAGTAGAAAGGGCAGGAAGCAGG - Intronic
1148467390 17:47873050-47873072 CAGAGGAGGGAGCAGGAGCCAGG + Intergenic
1148537711 17:48454815-48454837 TATTGGTAGGGGCAGGAAGCAGG + Intergenic
1148647947 17:49230089-49230111 CAGGGGCAGGGGCAGGGAGGTGG + Intronic
1148778642 17:50109749-50109771 GAGAGGGAGGGGGAGGAGGCTGG - Intronic
1148806666 17:50267289-50267311 CAGAGCCTGGGGGAGGAAGCTGG - Intergenic
1148862057 17:50609634-50609656 CACCGGGAGGGGCAGGCAGCCGG - Intronic
1148913222 17:50954449-50954471 CAGAGGAAGCAGCAGGAACTGGG + Intergenic
1149383652 17:56120566-56120588 CAGAGGAGGCGGCAGTAATCAGG - Intronic
1149865214 17:60147835-60147857 CAGAGTAAGAGGAAGGAGGCTGG + Intergenic
1150739150 17:67765656-67765678 CAGATGATGGGGCAGGAAGACGG - Intergenic
1150821198 17:68435812-68435834 CAGAGGAAGAGACAGGGAGCTGG - Intronic
1150943345 17:69717482-69717504 CTGCTGAAGGGGCTGGAAGCAGG - Intergenic
1151840684 17:76615269-76615291 GAGAGGCACGGGCAGGAACCAGG - Intergenic
1151990721 17:77572371-77572393 CAGATGGAGGGGCAGGAGGAGGG - Intergenic
1152010110 17:77707741-77707763 CAGAGGAGGGGCCGGGAAACTGG + Intergenic
1152034308 17:77862595-77862617 CAGAGGATGGGCCAGACAGCAGG - Intergenic
1152042745 17:77915072-77915094 CAGAGAAAAGGGCAGGAGGATGG - Intergenic
1152048378 17:77953849-77953871 AAGAGGAAGGGCCAGGGAGGAGG - Intergenic
1152221763 17:79072649-79072671 CAGAGGAAGGCAGAGCAAGCAGG + Intergenic
1152344273 17:79742004-79742026 CAGGGGCAGGGGCAGGGGGCCGG - Exonic
1152356864 17:79811709-79811731 CAGAGGAAGGTGGTGGAAGCGGG + Intergenic
1152534164 17:80940874-80940896 CAGAGGAAGAGGCAGGGTCCCGG - Intronic
1152559808 17:81072291-81072313 GAGGTGAAGGAGCAGGAAGCCGG - Intronic
1152633425 17:81420783-81420805 CTGGGGAAGGGACAGTAAGCGGG - Intronic
1152635576 17:81429323-81429345 CAGAGCAGGGGACAGCAAGCTGG - Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1153520912 18:5953174-5953196 CAGGAGAAGGGGAAGGGAGCTGG + Intergenic
1153778982 18:8477950-8477972 CAGTGGAAGCAGCAGGAAGGTGG + Intergenic
1153788991 18:8560789-8560811 CAGAGGAAGGGAGAGGGAGAGGG - Intergenic
1153810059 18:8744536-8744558 CACAAGAAGCAGCAGGAAGCAGG - Intronic
1154118702 18:11633868-11633890 CAGAAGCAGGGACAGGGAGCTGG - Intergenic
1154492645 18:14933445-14933467 GAGAGCAAGGGGCAGGAAATTGG + Intergenic
1155246919 18:23919655-23919677 CAGAGGGAGAGGCATGAAGAAGG + Intronic
1156121188 18:33845023-33845045 AAGAGGAAGAGACAGGAAGGGGG - Intergenic
1156952272 18:42916862-42916884 GAAAGGAAGGAGAAGGAAGCAGG + Intronic
1157019407 18:43761569-43761591 AAAAGGAAGGGGAATGAAGCAGG - Intergenic
1157161083 18:45315143-45315165 CAGAGGAAGCTTCAGGAGGCAGG + Intronic
1157175566 18:45449012-45449034 CAGAGGAAGGTGCAGCCAGCAGG + Intronic
1157302233 18:46487340-46487362 GAGGGAAAGGGGCAGGATGCAGG + Intronic
1157317315 18:46603169-46603191 CAGAGGAAGTGACTGGAAACAGG + Intronic
1157600772 18:48891937-48891959 GGGAGGAGGGGGCAGGAGGCCGG + Intergenic
1157684228 18:49629757-49629779 CATAGAAAGAGGCAGGAATCTGG + Intergenic
1157879589 18:51307915-51307937 CAGTGGAAGGGGAAGCAAACAGG + Intergenic
1158358618 18:56647937-56647959 GAGAGGAAAAGGGAGGAAGCAGG + Intronic
1158429879 18:57375748-57375770 CAGAGAAGGGGGCACCAAGCTGG - Intergenic
1158737391 18:60098789-60098811 AAGAGGAAGGAGGAGGAAGAAGG - Intergenic
1159489497 18:69112515-69112537 CAGAGGAAAGGGCAAGAAAATGG - Intergenic
1160381641 18:78461582-78461604 AAGAGGAAGAGGGAGGCAGCGGG - Intergenic
1160522665 18:79517401-79517423 CAGAGGATGGTGGAGTAAGCTGG + Intronic
1160726516 19:620081-620103 CTGAGGAAGGGGCGGCAAACGGG + Intronic
1161142957 19:2659644-2659666 AAGAGGAAGGGAGAGGAAGAGGG + Intronic
1161219296 19:3110684-3110706 CTGGGGAAGGGGCCGGAACCAGG - Intronic
1161273170 19:3401402-3401424 CAGAGGAGGGGGCAGAATCCAGG + Intronic
1161370534 19:3908640-3908662 AAGGGGAAGGGGGAGGAAGAAGG - Intronic
1161473193 19:4471597-4471619 TAGAGGAAGGGGCAGGCTCCGGG - Intergenic
1161747448 19:6069848-6069870 AAGAGGAATGGGGAGGCAGCTGG + Intronic
1161957998 19:7506856-7506878 CAGAGGAAGGGGGAGGAGCTGGG - Intronic
1162003621 19:7763722-7763744 CAGAGGTGGGGGTTGGAAGCTGG + Intronic
1162180851 19:8867756-8867778 CAGGTGAATGGGCAGGAAGATGG + Intronic
1162267761 19:9589872-9589894 AAGAGGCAGGTGCAGGCAGCGGG + Intergenic
1162386354 19:10362471-10362493 CAGAGGTGGGAGCAGTAAGCAGG + Intronic
1162477424 19:10908929-10908951 CAGGAGAGGGAGCAGGAAGCCGG - Intronic
1162565987 19:11446109-11446131 CTGAGGAGGGGGCAGGAGGGTGG + Intronic
1162736790 19:12751556-12751578 CAGAGGTTGGGGGAGGAGGCAGG - Intergenic
1162747153 19:12805221-12805243 CTGAGGAAGGGGCATGAGCCTGG + Intronic
1162796884 19:13091706-13091728 GAGAGGAAGGGACAGCAGGCGGG + Intronic
1163160505 19:15461389-15461411 CAGAGGCAGGGGCTGGAGGGAGG - Intronic
1163658394 19:18561711-18561733 CAGGGGATGAGGGAGGAAGCTGG + Intronic
1163664976 19:18598909-18598931 AAGGGGAGGGTGCAGGAAGCAGG + Intronic
1163816135 19:19465630-19465652 CAGCGGGAGGGGCTGGAACCTGG + Intronic
1164677391 19:30110805-30110827 CGGAGGACGGAGGAGGAAGCGGG - Intergenic
1164773805 19:30834739-30834761 CAGAGTGAGGGGCAGGAACTGGG - Intergenic
1165430476 19:35768982-35769004 CAGAGAGAAGGGCTGGAAGCAGG - Exonic
1165637573 19:37355102-37355124 CTGAGAAAGGGGAAGGAAGGAGG - Intronic
1166119031 19:40673880-40673902 GACAGAAAGGGGCAGGAAGCTGG - Intronic
1166134118 19:40765178-40765200 CAGGGGAAGGGGCAGGCATGGGG - Exonic
1166354189 19:42217344-42217366 CAGAGTCAGGGGCAGTCAGCAGG - Intronic
1166546047 19:43635470-43635492 GGGAGGAAGGGGCTGGAGGCGGG - Intronic
1166668743 19:44697469-44697491 CAGAGGAGGGGCCAGGGAGGTGG + Intergenic
1166678488 19:44753802-44753824 CTGGGGAGGGGGCAGGAAGGCGG + Intronic
1166705091 19:44904040-44904062 CAGAGATGGGGGCAGGGAGCTGG + Intergenic
1167322820 19:48806945-48806967 GAGAGGAGGGGGCTGGCAGCTGG - Intronic
1167357716 19:49014461-49014483 CTGAGGAAGAGGCAGAAAGAGGG - Intronic
1167465852 19:49650944-49650966 CAGAGGAGGGGGCAGGGGGTGGG - Exonic
1167495055 19:49812806-49812828 AAGAGGATGGGGCTGGGAGCTGG - Intronic
1167607532 19:50489456-50489478 CAGAGACCGGGGCAGGAAGCAGG + Exonic
1168171667 19:54594017-54594039 CTGAGGTGGGGGCAGGAACCAGG - Intronic
1168276985 19:55284145-55284167 CGGGGGGAGGCGCAGGAAGCGGG + Exonic
1168294098 19:55370335-55370357 CAGGGCAGGGGGCAGGGAGCCGG + Exonic
1168333897 19:55586036-55586058 GAGAGGGGGGGGCTGGAAGCAGG - Intergenic
924981712 2:228720-228742 CAGACGCAGGGGCAGGAGGCAGG + Intronic
925027075 2:618535-618557 CAGAGGCAGGGGCTGGACACCGG + Intergenic
925101487 2:1250166-1250188 CAGAGGAAGGGGCAGGAGGCTGG - Intronic
925198456 2:1947015-1947037 CTGATGAAGGAGAAGGAAGCTGG - Intronic
925360668 2:3278244-3278266 CAGCTGATGGGGCAGGATGCAGG - Intronic
925445363 2:3922647-3922669 AAGAGGAAGGGGAAGGAAAGAGG + Intergenic
925991600 2:9259400-9259422 GAGAGCAGGGCGCAGGAAGCGGG - Intronic
926230851 2:11002788-11002810 CAGAGAATGGGTCAGGAAGAGGG + Intergenic
926329834 2:11815249-11815271 CAGATGGAGGTGCAGGGAGCAGG - Intronic
926369248 2:12163700-12163722 GAGAGGAAGGGGAATGAAGGAGG - Intergenic
926407446 2:12570159-12570181 CAGAGCAAAGGGCAGGAGGAAGG - Intergenic
926434939 2:12827993-12828015 CAGAGGAATAGGCAGGCAGCTGG - Intergenic
926481339 2:13399674-13399696 CAGAGGATGGGGCTGGGAGGAGG + Intergenic
926954178 2:18275654-18275676 CAGAGGAAGGGCCTGGTAGGAGG - Intronic
927190199 2:20512156-20512178 CAGAGGCAGGGGCTGGAAACTGG - Intergenic
927256340 2:21043815-21043837 CAGAGGGAGCGGGAGGGAGCCGG - Intronic
927519496 2:23690380-23690402 AAGAGCAGGGGGCAGGGAGCTGG - Intronic
927665519 2:25029533-25029555 CTGAGGAAGGGGCAGCAATGTGG - Intergenic
927683427 2:25154940-25154962 GACAGCAAAGGGCAGGAAGCAGG + Exonic
927892799 2:26763008-26763030 GAGAGGGTGGGGCAGGAAACGGG - Intergenic
928102965 2:28450111-28450133 CAGAGGAGGGGGAAAGAAGGAGG - Intergenic
928142345 2:28740671-28740693 CAGAGGAAGTGGTAGGAAATAGG - Intergenic
928190017 2:29155755-29155777 CAGCGGGAGAGGCTGGAAGCAGG - Intronic
928270353 2:29849776-29849798 AAGAGGAGTGGGGAGGAAGCAGG + Intronic
928723147 2:34142866-34142888 GAGAGGCATGGGCAGGAACCTGG - Intergenic
929034717 2:37679741-37679763 AAGAGGAAGGCACAGGAGGCTGG - Intronic
929271866 2:39981471-39981493 GAGAAGAAGGGGTAGGAGGCTGG + Intergenic
929533586 2:42767157-42767179 CAGAGGAATGGGCAGGAGCGGGG + Exonic
929552980 2:42906049-42906071 CAAGGGAAGGGGCAGGGAACTGG + Intergenic
929781925 2:44962585-44962607 CAGAGGTGGGGGTAGGAAGGAGG - Intergenic
930719628 2:54626643-54626665 CAGAGGAGAGGTCAGGAACCAGG + Intronic
931218246 2:60265713-60265735 TACAGGAAGGAGCAGGAAGTGGG + Intergenic
931240798 2:60450637-60450659 CAGAGCATGGGGCAGGGAGAGGG + Intergenic
931340744 2:61398506-61398528 CAGGGGAAGGAGGCGGAAGCGGG + Intronic
931959179 2:67462873-67462895 CAGAGGATGGGGAAAGAAGAGGG + Intergenic
932356455 2:71071975-71071997 CAGAGCAAGGACCAGGCAGCAGG + Intronic
932544070 2:72688540-72688562 CAGGGGCAGGGGCAGGGGGCAGG + Intronic
932786943 2:74613891-74613913 GAGAGGCTGGGGCAGGAAGATGG - Intronic
933030846 2:77326818-77326840 CAGAGGAAGGGAAAGTAGGCTGG - Intronic
933389426 2:81651799-81651821 TAGAGGTAGGTGCAGGCAGCGGG + Intergenic
933669079 2:84989748-84989770 CAGGGGTGGGTGCAGGAAGCAGG + Intronic
933739823 2:85524694-85524716 CAGAGGGATGGGGAGGCAGCAGG + Intergenic
933949905 2:87319976-87319998 CAGAGGAAGAGGCAGGCTGTGGG + Intergenic
934067179 2:88350890-88350912 CAGAACAAGTGGCAGGAAGAAGG - Intergenic
934150112 2:89138400-89138422 AAGAGGAAGGGGCTGGTAACGGG - Intergenic
934217183 2:90043629-90043651 AAGAGGAAGGGGCTGGTAACAGG + Intergenic
934663203 2:96154041-96154063 CAGGGGCAGGGGCAGGACTCAGG + Intergenic
934712053 2:96522747-96522769 CTGAGCAAAGGGCAGGAGGCAGG + Intergenic
935032511 2:99336397-99336419 CAGAGGAAGGGGCGGGCGGTCGG + Exonic
936330287 2:111541621-111541643 CAGAGGAAGAGGCAGGCTGTGGG - Intergenic
937287495 2:120762511-120762533 CACAGGAAGGGGCAGGTCCCAGG + Intronic
937299610 2:120831213-120831235 CAGAAGAAGGGCCAGGCATCGGG - Intronic
937440134 2:121908319-121908341 CAGATGCAGGTGCAGGAGGCTGG + Intergenic
937562138 2:123239258-123239280 CAGAGGAAAAGACAGGAAGATGG + Intergenic
937711575 2:124985683-124985705 CAGAGGTATGTGCAGCAAGCAGG + Intergenic
937989867 2:127656328-127656350 CAGAGGCTGGGCCAGGAGGCTGG - Intronic
938676727 2:133643480-133643502 CAGATGAAGGGGCTAGAAGGAGG - Intergenic
938712465 2:133987348-133987370 CAGAGGACAGGACAGCAAGCAGG + Intergenic
938763542 2:134445436-134445458 CAAGGGAAGGGGCAGGAGGGAGG + Intronic
939087295 2:137736770-137736792 CAGAGGAAAGGGTAGGAAGGGGG + Intergenic
939198077 2:138998260-138998282 CAGAGTACAGGGAAGGAAGCAGG + Intergenic
939409517 2:141805989-141806011 AAGGGGAATGGGCAGGAAGTAGG + Intronic
939552765 2:143636120-143636142 CAGAGGAATGGGCTGGAAATGGG - Intronic
939898872 2:147826862-147826884 GAGAGGGACGGGCAGGAACCGGG + Intergenic
939995028 2:148911964-148911986 AAGAGGGAGGGGCAGGAGGAAGG - Intronic
941276672 2:163498469-163498491 CAGAGGAAGGAACAGGCAGCAGG + Intergenic
942299629 2:174548906-174548928 GAGAGGCAGGGGCAGGAACCGGG - Intergenic
942761513 2:179404108-179404130 CAGAGGAAGGGGTAGGATATGGG - Intergenic
943449377 2:188028764-188028786 CTAGGGAAGGGGAAGGAAGCCGG + Intergenic
943726528 2:191257034-191257056 AAGGGGAAGGGGGAGGAAGAGGG - Intronic
943906157 2:193502768-193502790 GAGAGGAACGGGCGGGAACCCGG - Intergenic
943976915 2:194493655-194493677 CAGAGAAAAGAGAAGGAAGCTGG + Intergenic
944460275 2:199941997-199942019 GAAAGGAAAGGGGAGGAAGCAGG - Intronic
944649992 2:201820365-201820387 GAAAGGCAGGGGCAAGAAGCTGG + Intronic
944827586 2:203501027-203501049 TAGAGAAAGGGGCAGGAGGGAGG + Intronic
945061794 2:205915805-205915827 TGGAGGAAGGGGCAGGAGCCAGG - Intergenic
945124281 2:206491146-206491168 CAGGGGTAGGGGCAGGCAGAGGG - Intronic
945307073 2:208268759-208268781 AAGAGGAAGGGGAAGGAAAGAGG - Intronic
945557987 2:211302670-211302692 GTGAGGTAGGGGCAGGAAGTAGG - Intergenic
946164139 2:217853582-217853604 AAGAGGAATGGGCAGGACACTGG - Intronic
947181810 2:227418000-227418022 CAGAGGAATGGGTAGGAGGCAGG - Intergenic
947382583 2:229559627-229559649 CAGAAGAAAGGGAAGGAAGGAGG + Intronic
947551727 2:231051310-231051332 CAGAGCAAGGGGCTGGGGGCGGG - Intergenic
947619552 2:231580809-231580831 TGGAGGAAGGGGGAGGACGCGGG + Intergenic
947763934 2:232623953-232623975 CAGATGTAGGGGCAGACAGCTGG + Intronic
947938056 2:234024641-234024663 GAGAGGCACGGGCAGGAACCGGG - Intergenic
947947687 2:234120570-234120592 CAAAGGAAGGGGGAGGCTGCTGG + Intergenic
948408948 2:237744070-237744092 AAGAGGCAGGGGCAGGGACCAGG + Intronic
948461957 2:238134125-238134147 CAGAGGAGGGGGCTGGAGGCAGG + Intergenic
948486318 2:238283544-238283566 CTGAGGAAGGTGCACGAGGCTGG + Intronic
948637902 2:239351891-239351913 CGCTGGAAGTGGCAGGAAGCTGG + Intronic
948702631 2:239769801-239769823 CAGAGGCAGGGGCAGAGTGCAGG + Intronic
948764296 2:240211671-240211693 CACGAGAAGGGGCAGCAAGCAGG + Intergenic
948832580 2:240605374-240605396 CACAGGAAAGGCCAGGAAGGAGG - Intronic
948887700 2:240892353-240892375 CAGGGGCAGGGGCAGGGGGCAGG - Intronic
948909267 2:240994767-240994789 CTGAAGCCGGGGCAGGAAGCCGG + Intergenic
1168804007 20:662337-662359 CAGGGGAAGGTTCAGGAAGGTGG + Exonic
1168824242 20:798642-798664 CAGAGGCAGGTGCAGACAGCAGG - Intergenic
1168862970 20:1059333-1059355 AAAAGAAAGGGGCAGGAATCAGG + Intergenic
1168967842 20:1910025-1910047 CACAGGAAGGGGCCGGGAGATGG + Intronic
1169001922 20:2174169-2174191 TAGAGGAAGGGGAAGCAGGCAGG + Intronic
1169045721 20:2533146-2533168 CAGGAGAAGAGGCAAGAAGCAGG + Intergenic
1169111494 20:3037053-3037075 AAGAGGTGGGGGCAGGCAGCTGG - Intronic
1169175037 20:3503757-3503779 CAGAGGAAGGGAGAGTAAGTAGG + Intronic
1169183917 20:3595761-3595783 AAGAGGAAAGGGCGGGAAGTGGG - Intronic
1169277829 20:4245446-4245468 AAGAGGAAGGGACAGGAGGAGGG + Intronic
1169313742 20:4570858-4570880 CAGTGGAAGTGGCAGGATGCTGG - Intergenic
1169365173 20:4986220-4986242 CAGAGGCGGGGGCAGGAGGATGG + Intronic
1169554623 20:6736195-6736217 CAGAGGAAAGGGAAGGAACTAGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1170374023 20:15680109-15680131 AGGAGGAAGGCACAGGAAGCAGG - Intronic
1170429112 20:16260569-16260591 AAGAGGCAGGGGAAGGAAGCAGG + Intergenic
1170528280 20:17262942-17262964 GACAGGAAGGAGAAGGAAGCTGG - Intronic
1170763996 20:19274723-19274745 CAGGGGGAGGGGCAGGAAAGGGG + Intronic
1170829905 20:19830971-19830993 CTGTGGAATGGGAAGGAAGCAGG - Intergenic
1171303001 20:24080081-24080103 ATGTGGAAGGGTCAGGAAGCTGG + Intergenic
1171937360 20:31287614-31287636 CAGAGGAAGGGGGATGAAAATGG + Intergenic
1172094621 20:32454599-32454621 CCGAGGCAGGGGCAGGAGACAGG - Intronic
1172623983 20:36337010-36337032 CGGAGGAAGGCGGAGGGAGCTGG + Intronic
1172643375 20:36455189-36455211 GAGAGGAAGGGAGGGGAAGCTGG - Intronic
1172837580 20:37882951-37882973 AAGGGGAAGGGACAGGAACCAGG + Intergenic
1172889262 20:38252566-38252588 CAGAGGGGGCGGCAGGAAACAGG - Intronic
1173016666 20:39232120-39232142 CATGGTCAGGGGCAGGAAGCAGG + Intergenic
1173054478 20:39597800-39597822 GACAGTAAGGGGCAAGAAGCAGG - Intergenic
1173138937 20:40465147-40465169 CCGAGGAAGGGTGCGGAAGCTGG + Intergenic
1173145779 20:40522930-40522952 CAGAGAAAAGGACAGGGAGCTGG + Intergenic
1173311993 20:41904940-41904962 CTGAGGACCAGGCAGGAAGCTGG + Intergenic
1173565981 20:44039062-44039084 CAGAGGGCTGGGCAGGCAGCCGG - Intronic
1173617809 20:44414273-44414295 CAGAGGAGGGGGCAGGGGGCAGG + Intronic
1173729473 20:45318345-45318367 CAGAGGCTGGTGCAGGTAGCTGG - Intergenic
1173778730 20:45735898-45735920 GAGAGGCACGGGCAGGAACCAGG + Intergenic
1173817653 20:46000162-46000184 CAGTGGAAGGGGCTGGATGCTGG - Intergenic
1174215626 20:48914103-48914125 CAGAAGAAGAGGCAGAAAGGGGG + Intergenic
1174431543 20:50473478-50473500 CTGAGGGAGGGACAGGGAGCGGG + Intergenic
1174452671 20:50629540-50629562 CACAGGACGGGGCAGCAGGCAGG + Intronic
1174524329 20:51159192-51159214 CAGTGAAAGGGGCTGGATGCAGG - Intergenic
1174634878 20:51990357-51990379 CAGAGGAAGACCCAGGAAGCTGG - Intergenic
1175034824 20:55989999-55990021 CAGAGGAAGGGGCATACAGTAGG + Intergenic
1175225536 20:57441874-57441896 CAGAGGAATGGGCAGGGGGAGGG + Intergenic
1175225542 20:57441886-57441908 CAGGGGGAGGGGCAGGGGGCAGG + Intergenic
1175582742 20:60113108-60113130 CAGGGGAAGTTGCACGAAGCAGG + Intergenic
1175632384 20:60552602-60552624 CAGAGGAAGGGGCTGGGACAAGG + Intergenic
1175726270 20:61320759-61320781 CAGATGAAGAGGCAGGAAAGGGG + Intronic
1175754859 20:61523024-61523046 CAGAGGAAGGAGCAGGAGGGAGG + Intronic
1175773089 20:61635864-61635886 CAGAGCAGGGGGCAGGACACAGG + Intronic
1176038619 20:63052527-63052549 CAGAGGAAGAGGCAGAAAGGAGG + Intergenic
1176126017 20:63475131-63475153 CAGAGGAGGGGACAGGGGGCAGG - Intergenic
1176285391 21:5016571-5016593 CAGAGGAAAGGACAGGACTCTGG - Intergenic
1178404518 21:32313209-32313231 CACAGGGAGGGGCAGCGAGCAGG - Exonic
1178520190 21:33282971-33282993 AATAGGAAGGAGCAGGTAGCAGG - Intronic
1178721713 21:35016591-35016613 CAGAAGAAGGAGCAGGATGAGGG - Intronic
1178724122 21:35036074-35036096 CAGAAGAGGGAGCAGGGAGCAGG + Intronic
1178763630 21:35428605-35428627 GACAGGGAGGGGGAGGAAGCTGG - Intronic
1178931114 21:36820132-36820154 CAAAGGAAGGGGCAGGGCCCAGG + Intronic
1179068149 21:38045855-38045877 CAGAGGAAGGGGCTGAACTCAGG + Intronic
1179075858 21:38121144-38121166 CTGAGGCAGGATCAGGAAGCGGG + Exonic
1179289448 21:40005953-40005975 AAGAGGCAGGGTCAGGAAGGAGG + Intergenic
1179607401 21:42525925-42525947 CAGAGGATGGGGATGGTAGCAGG + Intronic
1179871790 21:44246904-44246926 CAGAGGAAAGGACAGGACTCTGG + Intronic
1180070967 21:45435628-45435650 CAGAGGTGGGGTCAGGGAGCAGG + Intronic
1180235618 21:46458012-46458034 GAAAGGAAGGGGAAGGAAGCAGG + Intergenic
1181417409 22:22770677-22770699 CAGAGAAAAGGGCAGGGAGGTGG - Intronic
1181423474 22:22817967-22817989 CAGAGCAAAGGGCAGGGAGGGGG - Intronic
1181528211 22:23502050-23502072 CAGAGGAAAGGGCAGGTGGTGGG - Intergenic
1181558661 22:23686863-23686885 GTGAGGCTGGGGCAGGAAGCAGG - Intergenic
1181762468 22:25067685-25067707 GAGAGAAAGGGGCTGGAAGGAGG - Intronic
1181852757 22:25761743-25761765 CAGGGGCAGGGGCAGGCAGGAGG - Intronic
1181891087 22:26064156-26064178 CAGAGCACGGAGCATGAAGCAGG + Intergenic
1182010852 22:26999548-26999570 AAAAGGCAGGGGCAGGAGGCAGG - Intergenic
1182023752 22:27101469-27101491 GAGAGGCAGGGGAAGGAAGATGG - Intergenic
1182070725 22:27461915-27461937 GAGATGCAGGGGCAGAAAGCAGG + Intergenic
1182226101 22:28800219-28800241 CAGGGGCAGGGGCTGGGAGCGGG - Intronic
1182261824 22:29078427-29078449 CAGAGGAAAGCCCAGGCAGCAGG + Intronic
1182479349 22:30596862-30596884 GAGAGGCACGGGCAGGAACCAGG + Intronic
1182903271 22:33916746-33916768 CAGAAGTAGAGGCAGGAGGCTGG - Intronic
1183248319 22:36710824-36710846 GAGAGGCCAGGGCAGGAAGCAGG + Intergenic
1183272064 22:36868497-36868519 CAGAGGAGGTGGGAGGAAGGAGG + Intronic
1183316343 22:37139052-37139074 CAGAGGAGGTGGAAGGAAGGAGG + Intronic
1183325504 22:37189353-37189375 CACAGGAAGGGATAGGAAGTTGG - Intronic
1183507842 22:38219244-38219266 CAGAGCAGGGGGCAGGGAGGAGG + Intergenic
1183546661 22:38457767-38457789 AGGAGGAAGGGGCAGGAAGGAGG + Intergenic
1183569033 22:38638274-38638296 CAGAGGACTGAGCAGGAAGTGGG + Intronic
1183647127 22:39133385-39133407 GGGAGGAAGGGGCAGGAGGAAGG - Exonic
1183832576 22:40426196-40426218 CAGATGAGTGGGAAGGAAGCGGG - Intronic
1183930671 22:41234323-41234345 CAGAGGTGGGGGCAGGGAGGAGG + Intronic
1184161095 22:42697788-42697810 TGGAGGCAGGGGCAGGCAGCAGG - Intronic
1184273292 22:43396840-43396862 CAGGGCCTGGGGCAGGAAGCAGG + Intergenic
1184353648 22:43963147-43963169 TAGAGGTAGGGGCAGGAATAGGG - Intronic
1184615107 22:45632770-45632792 CAGAGGAAGGCGCAGGAGCCGGG + Intergenic
1184844354 22:47072126-47072148 CAGAGGCATGGCCAGGACGCTGG + Intronic
1184844736 22:47074748-47074770 AAGAGGACTGGGCAGGAAGGCGG - Intronic
1184935318 22:47716579-47716601 CAGAGGAAGGGCCTTGATGCCGG - Intergenic
1185055505 22:48576642-48576664 CAGCGGAACGTGCTGGAAGCCGG - Intronic
1185266659 22:49907531-49907553 CAGAGGAGGAGGCAGGAGGATGG + Intronic
1185416337 22:50712396-50712418 CAGAGGAGGCTGCCGGAAGCCGG - Intergenic
949128368 3:472615-472637 CAAATGAAGGGGCAGCAAGCAGG - Intergenic
949501172 3:4681168-4681190 GGGAGGAAGGGGCAGGAATGTGG + Intronic
949883738 3:8679326-8679348 AAGAGCAAGGGGCGGGAAGAGGG - Intronic
950107047 3:10394870-10394892 CAGTGGAAGGGGCTGGAGCCAGG - Intronic
950138992 3:10602130-10602152 CAGAGGCCAGGGCAGGAAGTGGG - Intronic
950520142 3:13493258-13493280 CAGAGGAGGTGGCAGGTAGGAGG - Intronic
950536864 3:13583841-13583863 TAGAGGACGGGGCTGGAAGCAGG - Intronic
950586341 3:13895201-13895223 CCGAAGAAGGGGAGGGAAGCAGG + Intergenic
950929358 3:16773718-16773740 GAGAGGCAGGAGCAGGAACCGGG + Intergenic
951024973 3:17818354-17818376 GAGAGGCATGGGCAGGAACCGGG - Intronic
951323235 3:21271980-21272002 GAGAGGCACGGGCAGGAACCAGG - Intergenic
951425103 3:22535495-22535517 AGGAGGAAGGGGCAGGAAGCAGG + Intergenic
951494373 3:23309906-23309928 TAGAGGAAGGTGGAGGAAGATGG + Intronic
951896144 3:27611647-27611669 CATAGGAAGAGGCAGCAGGCAGG + Intergenic
951990489 3:28671175-28671197 TGGAGGAAAGGGAAGGAAGCGGG - Intergenic
952410915 3:33048972-33048994 CAGAGGGAGGGGCAGGAGAGAGG + Intronic
952500758 3:33959659-33959681 GAGAGGGAGGAGGAGGAAGCAGG + Intergenic
952532940 3:34280634-34280656 AAGAGGAAAAGGCTGGAAGCAGG + Intergenic
953138595 3:40205880-40205902 CAGAGAAAGGAGCAGTAAGGAGG - Intronic
953201575 3:40782490-40782512 CAAAGGAAGGAGCAAGAAGTGGG - Intergenic
953676606 3:45007590-45007612 CTGAGGAAGGTGCAGGGACCTGG + Intronic
953850485 3:46462792-46462814 CAGAGAAGGGGGCAGGGAGCTGG + Intronic
953852002 3:46471623-46471645 CGGAGAAAGGAGCAGGGAGCGGG + Intronic
953879370 3:46683722-46683744 CAGAGGACAGGGTAGGAAGAGGG - Intronic
954110449 3:48430105-48430127 CAGAGGTGGGGGCCGGAAGGAGG - Intergenic
954196343 3:48999275-48999297 CAGAGGAAGAGGCGGGCATCGGG + Intronic
954218223 3:49136159-49136181 CAGGTGAAGGGCCAGGAGGCTGG - Intergenic
954407556 3:50353910-50353932 CAGAGAAAGGGGAAGGAAATGGG - Exonic
954432948 3:50480910-50480932 GGGAGGAAGGGGGAGGAAGGGGG + Intronic
954432953 3:50480920-50480942 GGGAGGAAGGGGGAGGAAGGGGG + Intronic
954567248 3:51608864-51608886 CAGAGGGAGGGGCAGGGGGAGGG + Intronic
954659424 3:52219040-52219062 CAGGGGCAGGGACAGGAAGCTGG - Intergenic
954994564 3:54869905-54869927 CAGATGAAGGGGAAGGAAAGTGG - Intronic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955406902 3:58631321-58631343 CTGAGGAAGGAGTGGGAAGCTGG + Intergenic
955678534 3:61475397-61475419 GAAAGGAAGGAGGAGGAAGCAGG - Intergenic
955694581 3:61623189-61623211 CCTTGGAAGGGGCAGGAATCAGG + Intronic
956334453 3:68147405-68147427 CAGAGGCAGGAGCAGAAAGTTGG - Intronic
956488046 3:69742038-69742060 CAGAGGAGGTGGTAAGAAGCGGG - Intronic
956731873 3:72203860-72203882 CAGAGGAAGAGGAAGGAAGTGGG + Intergenic
956785297 3:72637355-72637377 CACATGGAGGGGAAGGAAGCTGG - Intergenic
956892427 3:73625307-73625329 TAGAGGAAGGGGGAGGGAGAAGG - Intergenic
956920383 3:73921984-73922006 AAGGGGCAGGTGCAGGAAGCTGG - Intergenic
957711201 3:83861218-83861240 TAGAGGAAGGGCCCGGAAGGAGG - Intergenic
957877940 3:86173734-86173756 CACAGGCAGGAGCAGGAAGGTGG - Intergenic
959099259 3:101991873-101991895 CACAGGAGGAGCCAGGAAGCTGG - Intergenic
959673397 3:109005668-109005690 GCTAGCAAGGGGCAGGAAGCAGG - Intronic
960663213 3:120083407-120083429 AAAAGAAAGGGGCAGGAGGCAGG + Intronic
960720312 3:120618883-120618905 TAGAGGAAGGTGCAGGTGGCGGG + Intergenic
960720693 3:120622376-120622398 CAGGGGAAGGGGAAGGAGACTGG - Intergenic
960858520 3:122127530-122127552 CAGAGTATGGAGCAAGAAGCAGG + Intergenic
961340560 3:126214203-126214225 CAGAGGCCCGGGCAGTAAGCAGG - Intergenic
961635778 3:128331447-128331469 CTGAGGAAGGGGAGGGAAGAGGG - Intronic
961820063 3:129571393-129571415 CAGAGGCAGAGGGAGGAAGAGGG + Intronic
961957072 3:130815191-130815213 GAGAGGCACGGGCAGGAACCAGG - Intergenic
962080582 3:132135427-132135449 CAGAGGTTGGGGTAGGAACCAGG - Intronic
962244325 3:133779046-133779068 CTAAGGAAGGGGCAAGAAGGAGG + Intergenic
962367647 3:134796623-134796645 CGGGGGAAGGGGCGGGAGGCGGG - Intronic
962444831 3:135455046-135455068 CGGTGGTAGGGGCAGGCAGCAGG - Intergenic
962868353 3:139466508-139466530 CAGAGGAACTGGCAAGAGGCTGG + Intronic
962878487 3:139554165-139554187 CAGAGGAAAGGGACTGAAGCTGG - Intergenic
962967551 3:140368551-140368573 CAGGGGATCGGGCAGGAACCAGG - Intronic
963473688 3:145776523-145776545 CAGAGGAAGAGGGAGAAAGAGGG - Intergenic
964362483 3:155913111-155913133 CAGAGGAAGTGGTAGGAAGAGGG - Intronic
965327813 3:167329520-167329542 CAGAAAAAGGTGCAAGAAGCAGG + Intronic
965544290 3:169899566-169899588 CAGAGGAACTGAGAGGAAGCAGG + Intergenic
965820663 3:172681125-172681147 GAGAAGGAGGGGCAGGAAGAAGG + Intronic
965904229 3:173683275-173683297 AAGAGGAAGAGGAAGGAAGGAGG - Intronic
966884988 3:184372587-184372609 GAGCAGAAGGGTCAGGAAGCAGG + Exonic
967234137 3:187367928-187367950 GAGAGGCACGGGCAGGAACCGGG - Intergenic
967255859 3:187591231-187591253 CAGGGGGAGGGGCAGGGGGCGGG + Intergenic
967406463 3:189120902-189120924 CAGAGGAATGTGCAGGAAGTGGG + Intronic
967468635 3:189837177-189837199 CAGAGGAAGTAGCAGGAGACAGG - Intronic
967728073 3:192880456-192880478 TAAAGGAAGGAGGAGGAAGCAGG + Intronic
967875825 3:194267961-194267983 GAGAGGCAGGGCCAGGAAGGAGG + Intergenic
968523248 4:1043954-1043976 CAGAGCAGGGGGCAGGGACCTGG + Intergenic
968612802 4:1564701-1564723 CAGAGTGAGGGGCAGGATGGGGG + Intergenic
968740723 4:2330526-2330548 CAGAGGAAGGGACAGCATGGAGG + Intronic
968864057 4:3196351-3196373 CATAAGAGGGGCCAGGAAGCCGG - Intronic
968942933 4:3648514-3648536 GGCAGGAAGGGGCAGGGAGCTGG - Intergenic
969075489 4:4574849-4574871 GGGAGGAAGGGGGAGGAAGGAGG - Intergenic
969567280 4:7985949-7985971 CCCAGCAAGGGGCAGGAAGTGGG - Intronic
969581945 4:8070941-8070963 CAGAGGGTGGGGCTGGAAACAGG + Intronic
969595622 4:8147977-8147999 CAGAAGAAGGGGCACGAGTCAGG + Intronic
969707442 4:8819594-8819616 CAGGGGAAGGGGAAGGGAGTAGG + Intergenic
970150595 4:13085550-13085572 CAGATGATGAGGCAGGAAGCAGG - Intergenic
970239403 4:13992742-13992764 AAGAGAAATGGGCAGGAACCAGG - Intergenic
970389565 4:15594029-15594051 CAGAGGAAGGGGGAGAGAGGTGG - Intronic
970425335 4:15940741-15940763 CAGAGGCAAAGGCAGGAAGTGGG - Intergenic
970463949 4:16304456-16304478 CAGAGGCAAAGGCAGGAAGTGGG + Intergenic
972661294 4:41119032-41119054 AGGAGGAGGGGGCAGGAAGATGG + Intronic
972731694 4:41801205-41801227 CTGAGGAAGTGGCAGAACGCAGG - Intergenic
972785033 4:42318725-42318747 TAGAGGAAGGTGCAGGTGGCAGG - Intergenic
973058215 4:45687050-45687072 CGGAGGAAGGGGGAAGAAGCAGG + Intergenic
973684383 4:53354435-53354457 AAGAGGCACGGGCAGGAACCAGG - Intronic
973795409 4:54420499-54420521 CAGAAGAATGGGTAGGAATCAGG - Intergenic
973878086 4:55241503-55241525 GAGAGGCACGGGCAGGAACCAGG + Intergenic
974693715 4:65337364-65337386 AAGAGGAAGGGGAAGGGAGGAGG - Intronic
975171923 4:71241880-71241902 AGGAGAAAGGAGCAGGAAGCTGG - Intronic
975272179 4:72449078-72449100 CAGAGAAAGAGTCAGTAAGCTGG - Intronic
975442029 4:74421808-74421830 GAGGGGAAGGGGAAGGAAGATGG + Intergenic
975687633 4:76933267-76933289 GAAAGGAAGGGGGATGAAGCAGG - Intergenic
975694084 4:76994358-76994380 AAGAGGAAGGGGCAGGTACAAGG + Intronic
976102464 4:81580452-81580474 GAGAGGCGGGGGCAGGAACCGGG + Intronic
976775327 4:88699627-88699649 CAGATGCAGGGGCAGAAAACAGG + Intronic
977153495 4:93544077-93544099 CAGAGGAAAGTGCAGGAAATTGG + Intronic
977254733 4:94727936-94727958 GACAGGCAGGTGCAGGAAGCCGG - Intergenic
978133342 4:105226637-105226659 GAGAGGAAGAGGGAGGAAGAGGG - Intronic
978383657 4:108157976-108157998 CAGAGGACTGGACAGGGAGCAGG - Intronic
978411778 4:108433927-108433949 CGGAGGAAAAGGAAGGAAGCAGG + Intergenic
978691874 4:111523595-111523617 CAGAGGAAGGTTCAGGATTCAGG + Intergenic
978923574 4:114216636-114216658 AAGCTGAAGGGGGAGGAAGCTGG + Intergenic
980084863 4:128380570-128380592 CAGTGGCAGGTCCAGGAAGCAGG - Intergenic
980447518 4:132930397-132930419 CAGAGAAAGGGAGAGGAAGATGG - Intergenic
981360786 4:143843349-143843371 TAGAGGAAGGGAAAGGAAGAGGG + Intergenic
981360794 4:143843381-143843403 TAGAGGAAGGGAAAGGAAGAGGG + Intergenic
981492710 4:145357212-145357234 CAGAGGCTGGGGCAGGTAGTAGG + Intergenic
981761807 4:148202779-148202801 CAGAGGAAGGGGGATGAGGGGGG - Intronic
981782868 4:148445512-148445534 CCGAGGAAGGGGCCGAGAGCCGG + Intergenic
982091062 4:151880454-151880476 CAGAGGAAAGGAAAGGAACCGGG - Intergenic
982096813 4:151930867-151930889 CAGAGGAAGGGGGAAGCAGAGGG - Intergenic
982117231 4:152107752-152107774 AAAAGGAAGGGGCAGGGAGATGG + Intergenic
982336476 4:154244901-154244923 CATTGGAAGGGGCAAGCAGCAGG - Intronic
982514381 4:156326532-156326554 CAGAGAAAGAGACTGGAAGCCGG + Intergenic
982678186 4:158400012-158400034 GAGAAGAAGGGGCAAGAAACAGG - Intronic
982806911 4:159777401-159777423 CAGAGGTGGGGGCAAGAAGCAGG - Intergenic
983946259 4:173589082-173589104 CAGAGGCAGGGGCAGAAGGAAGG - Intergenic
985216773 4:187661668-187661690 AAAAGGAAGGGGAAGGAAGAAGG - Intergenic
985556448 5:560930-560952 CACAGGAAGGTGCAGGACGCAGG - Intergenic
985769231 5:1798753-1798775 CAGCAGATGGGGCAGGAGGCCGG + Exonic
985790856 5:1926297-1926319 CAGGGGAAGGGGCAGGCACAGGG - Intergenic
986365345 5:7023198-7023220 CAGAGGAATGCACAGGCAGCTGG - Intergenic
986588440 5:9343774-9343796 CAAAGGAAAGGGAAGGAAACTGG - Intronic
986824070 5:11501711-11501733 CATAAGAAGGGGCAGGAGGCTGG + Intronic
986963562 5:13244206-13244228 GAGAGGCACGGGCAGGAAGCGGG + Intergenic
987122890 5:14784351-14784373 CAGAGGAAGGAGCACCAGGCAGG - Intronic
988814941 5:34825590-34825612 GAGAGGAAGGGGGAGGAATGTGG + Intronic
989326908 5:40207702-40207724 CAGAGGAGGCGGCAGGAAATGGG + Intergenic
989398470 5:40983820-40983842 CACAGGAAAGGGCAGGAAGATGG - Intergenic
990050794 5:51497384-51497406 GAGAGGGATGGGCAGGAAGGTGG - Intergenic
990130658 5:52579118-52579140 AAGAGGAGGGGGCAGGAAGAAGG - Intergenic
990499903 5:56385739-56385761 AAGAGGAGGGGGCAGGAGGAAGG - Intergenic
991361102 5:65821090-65821112 CAGCGGCAGGGGCAGGAATGGGG + Intronic
991947647 5:71915238-71915260 CAGGGGAAAGAGCAGGAAGGAGG - Intergenic
992418538 5:76577971-76577993 CACAGGCTGGGGCAGGAAGAAGG - Intronic
992557241 5:77915868-77915890 CAGAGGTTGGGGGAGGATGCAGG + Intergenic
993150112 5:84151007-84151029 AAGTTGAAGGGGCAGGAAGGAGG + Intronic
993485216 5:88475715-88475737 TGGAGGATGGGACAGGAAGCTGG - Intergenic
993611586 5:90060869-90060891 CAGAGGAAGAGGCAGGTAGCAGG - Intergenic
993674759 5:90803572-90803594 CAGATGAATGGGCAGGAATATGG + Intronic
994322028 5:98405347-98405369 TAGAAGAAGGGGTAGGCAGCTGG - Intergenic
994387294 5:99147000-99147022 CAGAGGAAGAATCAGGAATCAGG + Intergenic
995095440 5:108230565-108230587 CAGAGGAAAGGGTAGGAGGGGGG + Intronic
995687128 5:114783217-114783239 CAGAGGATGGGGCACAGAGCAGG - Intergenic
996406638 5:123111768-123111790 CAAGGGAAGAGGCAGGAAGCGGG - Intronic
996678831 5:126208024-126208046 CAAGGGAAAGGGCAGGAGGCAGG + Intergenic
996823896 5:127660059-127660081 CTGAGGAAGGGCACGGAAGCTGG - Intergenic
997298111 5:132782256-132782278 CTGAGGAAGGGGCAGAACTCAGG + Intronic
997465696 5:134086683-134086705 AAGGGGAAGGGGAAGGAAGAAGG - Intergenic
997871052 5:137505434-137505456 GAGTGGAGGGGGCAGGATGCTGG - Intronic
998057279 5:139088912-139088934 AAAAGGAAGGGGGAGGAAGTAGG - Intronic
998552442 5:143090517-143090539 TAGAGGAAGGTGCAGGTGGCGGG + Intronic
998826501 5:146106942-146106964 CTGAGGCAGGGGCATGTAGCTGG - Intergenic
999311598 5:150555186-150555208 CGGAGGAAGGGACAGGAACCTGG - Exonic
999391869 5:151199178-151199200 CAGAGGAAGGGTTAGGACTCTGG - Intronic
1000302115 5:159965661-159965683 CAGAGGAAGAAGGAGGAAGGAGG + Intronic
1000315522 5:160086719-160086741 CAGAGGCTGAGGCAGGAAGATGG - Intronic
1000399522 5:160811591-160811613 CATAGGCAGGGGTAGGAAGAGGG - Intronic
1000598868 5:163248297-163248319 CAGAAGAAGGTGGAAGAAGCTGG + Intergenic
1001049352 5:168402146-168402168 CAGAGGGAGGGGAAGAAAGGAGG - Intronic
1001053473 5:168430876-168430898 AAGAAGAAAGGGCAGGAAGGCGG + Intronic
1001109741 5:168885700-168885722 CAGAGGCAGGGGGAGCAAACAGG + Intronic
1001273422 5:170332643-170332665 CAGAGGAAGCCCCAGGTAGCAGG + Intergenic
1001277726 5:170362690-170362712 CAGAGAATTGGGCAGGAATCAGG + Intronic
1001843530 5:174901523-174901545 GAGAGGCATGGGCAGGAACCAGG + Intergenic
1001854234 5:174996872-174996894 GAGAGGAAGGGAGAGGAAGAAGG + Intergenic
1001889430 5:175326874-175326896 CAGAGGATGGGGCTGGAGGCTGG - Intergenic
1002106935 5:176884148-176884170 GAGAGGAAGTGGCAGGAAGCTGG + Intronic
1002253630 5:177944023-177944045 CAGAGGTAGGAGCAGGGCGCAGG - Intergenic
1002584052 5:180230301-180230323 CAGAGGAAGGTTCAGGAGACAGG + Intergenic
1002757981 6:179575-179597 GAGAGGCAGGGGCAGGAACTGGG + Intergenic
1002758478 6:183509-183531 AAGAGGAGCGGGCAGGCAGCTGG + Intergenic
1002795094 6:465631-465653 AAGAGGATGGGGCAGGTGGCGGG - Intergenic
1002833455 6:845239-845261 CAGAGTAAGAGGGAGGATGCAGG + Intergenic
1003527707 6:6911693-6911715 CCAATGAAGGGGGAGGAAGCAGG - Intergenic
1003772202 6:9318290-9318312 CAGAGGACAGGCCAGGGAGCAGG - Intergenic
1004123616 6:12850800-12850822 CAGAGGCACGTGCAGGAAGAGGG - Intronic
1004170886 6:13294771-13294793 GAGAGGGAGGAGCTGGAAGCCGG - Intronic
1004617381 6:17303499-17303521 CAGAGGAAGGGGGGGGAGGGGGG + Intergenic
1004648657 6:17587614-17587636 CAGAGGAAGGGAGAGCAAGAGGG - Intergenic
1005487000 6:26310085-26310107 CAGAGAAAAGAGCAAGAAGCGGG + Intergenic
1005491735 6:26353654-26353676 TAGTGGAAGTGGGAGGAAGCGGG - Intergenic
1005622268 6:27630977-27630999 CAGAGGGAGGGGCAGGCGGCGGG + Intergenic
1006335900 6:33420372-33420394 CAGGGGGAGGGGCAGGGGGCGGG + Intronic
1006338075 6:33431447-33431469 CAGGGGAATGGGCAGGGAGCAGG - Intronic
1006388646 6:33746263-33746285 CACGGGAGGGGGCAGGAGGCCGG - Intronic
1006398492 6:33802198-33802220 CAGAGGAAGGCACAGGGGGCAGG + Intronic
1006452924 6:34115483-34115505 CAGGGGAAGGGGCAGCAATTTGG - Intronic
1007423201 6:41731964-41731986 CAGAAGAAAGGCCAGGAAACAGG + Intronic
1007664957 6:43508617-43508639 CTCAGGAAGGGGCAGGACGGGGG - Intronic
1007704065 6:43780591-43780613 CGGAGGAAGTGTCAGGAGGCAGG - Intronic
1007742753 6:44022829-44022851 GAGAGGATGGGGCTGGAGGCGGG - Intergenic
1007927838 6:45663937-45663959 CATGTGAAGGGCCAGGAAGCCGG - Intronic
1008332499 6:50260895-50260917 AAGCGGAAGGGGAAGCAAGCTGG - Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008535560 6:52504158-52504180 CAGAGGAGGAGCCAGCAAGCTGG + Intronic
1008863236 6:56176906-56176928 GGGAGGAAGGGGGAGGAAGGGGG + Intronic
1008920807 6:56843245-56843267 AAGAGGAAGGAGCAGCACGCTGG + Intronic
1009595424 6:65729276-65729298 CAGACGAAGGGGTGGGAAGGAGG - Intergenic
1010016293 6:71108275-71108297 CAGAGGAAGGAGCAGGAGGCAGG - Intergenic
1010373705 6:75141425-75141447 CAGCAGACGGAGCAGGAAGCAGG + Intronic
1011129361 6:84037800-84037822 GAGAGAGAGGGGCAGGAACCCGG - Intronic
1011570425 6:88728724-88728746 TAGAGGAAGGTACAGGCAGCGGG - Intronic
1011805056 6:91062214-91062236 CAGAGGAAGGGGCAGGGGTGGGG + Intergenic
1012131259 6:95496945-95496967 GAGAGGCACGGGCAGGAACCGGG + Intergenic
1012426506 6:99120982-99121004 CAGAGGAAGGGGGTGGAAAGGGG + Intergenic
1012523646 6:100151016-100151038 CAGAGAAAGGAGCAGCTAGCAGG + Intergenic
1013034725 6:106370290-106370312 CAGAAGAAGGGGTACGAAGTAGG - Intergenic
1013180049 6:107709546-107709568 CACAGGCAGAGGAAGGAAGCTGG - Intronic
1014035945 6:116766438-116766460 GAGATGAAGAGGTAGGAAGCTGG - Intergenic
1014215949 6:118752844-118752866 CAGAGGAATGGGGCGGTAGCTGG + Intergenic
1014220542 6:118794721-118794743 CATATGAAGAGGCAGGAAGAAGG + Intergenic
1014789603 6:125657573-125657595 CAGAAGAATGGCCAGGTAGCAGG + Intergenic
1015201443 6:130585987-130586009 CAGAGGCAGCAGCATGAAGCAGG + Intergenic
1015471633 6:133612785-133612807 CAGAGGAAGGAGCATGCAGAGGG - Intergenic
1015601010 6:134910491-134910513 CAGAGGAAGGGGCAGGAGAGGGG - Intergenic
1016347962 6:143136291-143136313 CAAAGGAAGTGGTAGGAAGTGGG - Intronic
1016598511 6:145828614-145828636 CAGAGAACGGGGAAGGAAGAGGG + Intergenic
1016655799 6:146517127-146517149 CTGGGGAAGAGCCAGGAAGCTGG + Intergenic
1016985375 6:149890908-149890930 GAGAGTAACAGGCAGGAAGCTGG + Exonic
1017229151 6:152053388-152053410 AGGAGGAAGGGGCAAGAAACTGG - Intronic
1017445813 6:154506300-154506322 GAGAGGAAAGGGGAGGAAGGAGG + Intronic
1017791670 6:157805211-157805233 CAGAGGGAGGGTCAGGATGAAGG - Intronic
1017891117 6:158640115-158640137 CACAGCAGGGGGCAGGAAGGTGG - Intronic
1017993093 6:159506899-159506921 GACAAGAAGGGGCAGGAAGATGG - Intergenic
1018420913 6:163640668-163640690 CAGAGGCTGGGGCAGCAGGCAGG - Intergenic
1018791044 6:167147983-167148005 AAGAGGGAGGAGGAGGAAGCAGG - Intronic
1018983434 6:168617459-168617481 CTGAAGACGGGGCAGGAAGCTGG + Intronic
1019058896 6:169241992-169242014 CAGAGGACGGGGCCAGCAGCAGG + Intronic
1019320829 7:414535-414557 GAGAGGACGGGGGAGGAAGGAGG - Intergenic
1019604104 7:1899892-1899914 CAGAGGAAGATGGAGGACGCGGG + Intronic
1019631641 7:2052811-2052833 CAGAGGAACCGGGAGGGAGCTGG + Intronic
1019718474 7:2554236-2554258 CAGAGGCTGGGACAGGGAGCAGG - Intronic
1019931659 7:4227318-4227340 CCCAGGAAGGGGTGGGAAGCCGG - Intronic
1020000549 7:4753357-4753379 CAGAGGAAAGGGCAGCAAGGCGG + Intronic
1020262263 7:6536968-6536990 CAGAGGGAGGGGCAGGCTGCGGG + Intronic
1020992012 7:15209851-15209873 CAAAGGGAGAGGCAGGCAGCAGG + Intronic
1021786390 7:24156815-24156837 GAGAAGAGGGGGAAGGAAGCAGG - Intergenic
1022043595 7:26604037-26604059 AAGAGCAAGGAGCAGGAATCTGG + Intergenic
1022924268 7:35044297-35044319 GAGAAGAAGGGGCAGGAAGAGGG - Intergenic
1022963671 7:35454073-35454095 CAGAGGCAGGGGCCAGAAGGGGG - Intergenic
1023027456 7:36063628-36063650 CTGTGGATGGAGCAGGAAGCAGG + Intergenic
1023724899 7:43132766-43132788 CAGAGGAAGGGGAAGAGACCAGG - Intronic
1023882850 7:44330218-44330240 CAGATGCAGGAGCAGAAAGCTGG - Intronic
1023897367 7:44445124-44445146 GAGTGTAAGGGGCAGGCAGCAGG - Intronic
1024037810 7:45523673-45523695 CAGAGCAAGAGGCAGGATGGTGG + Intergenic
1024617565 7:51128524-51128546 GAGAGGGAGGGGCGGGGAGCAGG + Intronic
1024988064 7:55213052-55213074 CAGAAGTGAGGGCAGGAAGCAGG + Intronic
1025062549 7:55823157-55823179 CAGAGGAAAGTGCACCAAGCAGG - Intronic
1025752795 7:64307733-64307755 CAGAGGAAGGGGCAGGGATGAGG - Intronic
1026212660 7:68319553-68319575 ATGAGGAAGGGGCAGGCTGCTGG - Intergenic
1026250544 7:68666217-68666239 CAGAGAGAGAGGCAGGAAGAGGG - Intergenic
1026254204 7:68696809-68696831 AAGAGTAAGGGCCAGGAAGATGG - Intergenic
1027251547 7:76401735-76401757 CAGAGGAAGGGGCTCCAAGCTGG - Intronic
1027916814 7:84334832-84334854 CAGGGGAAGAGCCAGGGAGCAGG - Intronic
1028451799 7:90993514-90993536 AAGAAGAAGGGGAAGGAAGGAGG + Intronic
1029008028 7:97230576-97230598 CACAGGCAGGTGCAGGAACCAGG - Intergenic
1029364156 7:100106625-100106647 CAGAGGCAGGGAGAGGAAGGAGG - Intronic
1029477223 7:100792219-100792241 CAGAGCTTGGGTCAGGAAGCGGG - Intronic
1029488278 7:100856495-100856517 AAGAAGAAGGGGCAGGGCGCCGG - Intronic
1029530531 7:101122306-101122328 GAGAGAAGGGAGCAGGAAGCGGG + Intergenic
1029608270 7:101613012-101613034 CAGAGGAGGGGGCAAAAAGTGGG - Intergenic
1029661020 7:101961769-101961791 CAGAGGCTGAGGCAGGAAGATGG + Intronic
1029822576 7:103160063-103160085 GAGAAGAAGGGGCAGGAAGACGG - Intergenic
1030631013 7:111895887-111895909 CAGATAAGGGGGCAGGAAGAGGG - Intronic
1031986127 7:128165955-128165977 CAGGGGCAGGGGCAGGAAGAGGG + Intergenic
1032089836 7:128905914-128905936 CAGAGGAGGGCACAGGAGGCAGG - Intronic
1032092409 7:128917617-128917639 CAGAGGAGGGCACAGGAGGCAGG + Intergenic
1032222574 7:130005891-130005913 CAGTGGAAGGGGAAAGCAGCTGG - Intergenic
1033097493 7:138443572-138443594 TAGAGGAAGGTGCAGGCAGTGGG + Intergenic
1033711487 7:143950856-143950878 CAGAGGCCGGGGCAGGAAAATGG - Intergenic
1033733041 7:144196597-144196619 GAGAGGAAGAGGCAGGGAGAGGG - Intergenic
1033743893 7:144295177-144295199 GAGAGGAAGAGGCAGGGAGAGGG - Intergenic
1033750008 7:144354390-144354412 GAGAGGAAGAGGCAGGGAGAGGG + Intergenic
1033770311 7:144543825-144543847 GAGAGGAAAGGGAAGGGAGCAGG - Intronic
1034356722 7:150456392-150456414 CAGAGGAAGGAGCAGGAGCCAGG - Intronic
1034989498 7:155539022-155539044 CAAAGAAAGGGGCCCGAAGCTGG - Intergenic
1035024808 7:155818575-155818597 CACAGGAAGGGGCAAGGAGGGGG - Intergenic
1035297300 7:157874382-157874404 GACAGGAGGGGGCAGAAAGCAGG - Intronic
1035350494 7:158242188-158242210 CAGAGGACGGGGCGGGGAGGAGG - Intronic
1035911584 8:3572281-3572303 CAGAGCCTGGGGCAGAAAGCAGG + Intronic
1036131905 8:6123282-6123304 CAGAAGAAGGTGGAAGAAGCAGG - Intergenic
1036465400 8:8992685-8992707 CAGAGAAAAAGGAAGGAAGCAGG + Intergenic
1036560788 8:9898916-9898938 CGGAGTCGGGGGCAGGAAGCGGG - Intergenic
1036604504 8:10293716-10293738 GAGAGGGAAGGGGAGGAAGCAGG - Intronic
1036648314 8:10625744-10625766 CAGAGGGCCTGGCAGGAAGCGGG + Intronic
1037548274 8:19944959-19944981 AAGGGGAAGGGGAAGGAAGGAGG - Intronic
1037601149 8:20395274-20395296 CAGAGCAGGTGGCAGGAACCTGG - Intergenic
1037833291 8:22201457-22201479 AAGAGAAAGGAGCAGGACGCAGG - Intronic
1037882073 8:22578423-22578445 CAAGGGAGGGGGCAGGAAGCGGG + Intronic
1037934958 8:22909271-22909293 CAGAGGATGGGGTAGGGAGAAGG - Intronic
1038395406 8:27242422-27242444 CAGGGGATCGGCCAGGAAGCAGG + Exonic
1038440723 8:27569270-27569292 CAGAGGCATGGGCAGGAAAAGGG + Intergenic
1038561758 8:28586903-28586925 CTGAGGCAGCGGCAGGAACCAGG + Intergenic
1038646248 8:29364934-29364956 CAGAGGATGGGGCAGAGATCTGG + Intergenic
1038780989 8:30568400-30568422 CAGAGTGAGGGGCAGGCAGCGGG + Intronic
1038860938 8:31388106-31388128 GAGAGGAAGGGAAAGGAAGAGGG - Intergenic
1039042986 8:33425592-33425614 CAGAGGAAGGGGGAGGGTGGAGG + Intronic
1039722034 8:40174529-40174551 CAGAGGATTGGGCAGCAAGCTGG - Intergenic
1039890441 8:41682190-41682212 CACAGGACGGGGCTGGAGGCGGG - Intronic
1041321243 8:56615138-56615160 AAGAGGAAGGGGAAGGAGGGAGG - Intergenic
1041344586 8:56883496-56883518 CAGGGGAAGGGGTGGGAGGCGGG + Intergenic
1041380968 8:57254194-57254216 CCAAGGAAGGAGCTGGAAGCTGG - Intergenic
1041623520 8:59999866-59999888 GAGAGGCACGGGCAGGAACCAGG + Intergenic
1042047427 8:64669438-64669460 CAGGGGCAGGGGCAGGAAAAAGG + Intronic
1042082947 8:65075923-65075945 AAGATGAAGGGGAAGAAAGCAGG + Intergenic
1042087834 8:65128147-65128169 TAGAGGAAGGTGCAGGCAGTGGG + Intergenic
1042335995 8:67630726-67630748 GAGAGGCACGGGCAGGAACCAGG + Intronic
1042533765 8:69839173-69839195 GATGGGAAGGGGAAGGAAGCAGG + Intergenic
1042758658 8:72246803-72246825 AAGAGAAAGGGGCAGGGAGTTGG - Intergenic
1043965684 8:86472440-86472462 CAGCTGAAGGGCCAGGAAGTGGG - Exonic
1044113999 8:88311974-88311996 GAGAGTAAGGGGCAGAAAACTGG + Intronic
1044700030 8:94957385-94957407 CAGAGGAAAGGGCTGAAAGCTGG + Intronic
1044706174 8:95010866-95010888 AAGACAAAGGGGAAGGAAGCAGG + Intronic
1044769366 8:95613888-95613910 CAGGGAAAAGGGCAGGAAGGGGG - Intergenic
1044946701 8:97396294-97396316 CAGAAGATGGGGAGGGAAGCGGG - Intergenic
1045105388 8:98887760-98887782 CAGAGCAAGGAGCAGTCAGCAGG + Intronic
1045431095 8:102115762-102115784 CAGAGGAAGGCTAAGGATGCTGG - Intronic
1045701292 8:104869873-104869895 CAGAGAAAGGAGCAGGAGCCAGG + Intronic
1046521431 8:115330922-115330944 AAGAGGCACGGGCAGGAACCTGG - Intergenic
1046545747 8:115648219-115648241 CAGAGGGAGTGGGAAGAAGCGGG + Intronic
1047252745 8:123192975-123192997 CAGGGGAAGCGGCTGGAGGCAGG + Intronic
1047446863 8:124927617-124927639 CAAAGGAAGGAGGAGGAAGCCGG + Intergenic
1047904040 8:129453793-129453815 CTGAGGATAGGGCAGGATGCTGG - Intergenic
1048054132 8:130847204-130847226 CAGAGGAGGGGACAGGAAAGAGG + Intronic
1048061691 8:130925511-130925533 TACAGGAAGAGGCAGGAAACAGG + Intronic
1048266307 8:132990565-132990587 CAGAGGGAGGGGGAGGAGACAGG - Intronic
1048286397 8:133145173-133145195 CAGAGGAAGAGGAAGGCAGAAGG + Intergenic
1048301655 8:133255712-133255734 CAGGGGATGGGGCAAGAGGCAGG + Intronic
1048308915 8:133303283-133303305 AGGAGGGAGGGGCAGGAAGAAGG - Intergenic
1049239242 8:141528586-141528608 CAGAGGAGGGAGGAGGGAGCAGG + Intergenic
1049270559 8:141693439-141693461 CTGAGGGATGGGCAGGAAGGAGG + Intergenic
1049326214 8:142022843-142022865 CAGAGGAAGGTTCAGTAAGTTGG + Intergenic
1049329503 8:142042785-142042807 CAGAGAAAACGGGAGGAAGCGGG + Intergenic
1049341120 8:142113194-142113216 CCTGGGAAGGAGCAGGAAGCAGG - Intergenic
1049589620 8:143451177-143451199 CAGAGCAGAAGGCAGGAAGCAGG + Intronic
1049620474 8:143596151-143596173 CAGAGGAGGCGGGAGGCAGCGGG + Intronic
1049653876 8:143789309-143789331 CCGAGGGAGGGCCAGGAAGCTGG + Intergenic
1049812041 8:144579964-144579986 CCGAGGCAGGGACAGGAGGCTGG - Intronic
1050016294 9:1237515-1237537 CAGAGGAAAGTGCAGCAAACGGG + Intergenic
1050227101 9:3471897-3471919 CTAATGAAGGGGCAAGAAGCTGG - Intronic
1050406120 9:5310088-5310110 GAGAGCAGGGTGCAGGAAGCAGG + Intergenic
1050790555 9:9463380-9463402 GGGAGGGAGGGGCAGGAAGAGGG + Intronic
1050886141 9:10768755-10768777 CAGAGTAGGGGGCAGGGAGATGG - Intergenic
1051725914 9:20088302-20088324 CAGAGGGAGGGGCAGGCTGCCGG + Intergenic
1051765962 9:20524024-20524046 CAGGGGAAGTGGCAGGGAGAAGG + Intronic
1051906200 9:22097272-22097294 TAGAGGAAGTGGCAGGAATTTGG + Intergenic
1052839415 9:33279316-33279338 GAGAGCAAAGGGCAGGGAGCAGG + Intronic
1052974982 9:34403484-34403506 CAAAGTAAGGGGCAGAAGGCTGG + Intronic
1052987922 9:34501731-34501753 CTGAGGAGGAGGCAGGAAGGGGG - Intronic
1053051478 9:34964539-34964561 ATAAGGAAGGGGAAGGAAGCTGG - Intronic
1053307211 9:36993545-36993567 CAGAGAAAGGGACAGGAAGAAGG + Intronic
1054764148 9:69029010-69029032 CACAGGAAGAGGCAGCAAGAGGG - Intergenic
1055248633 9:74276289-74276311 GAGAGGCACGGGCAGGAACCGGG - Intergenic
1055370420 9:75592655-75592677 CAGAGGTAGAGGCAGGGACCAGG - Intergenic
1055457555 9:76487216-76487238 CAAGGGAAGGAGCAGGAAACAGG - Intronic
1055776571 9:79772469-79772491 CAGAAGAAATGGCAGGAAGGAGG + Intergenic
1056179095 9:84064260-84064282 AAGAGGCAGGGGCAGGGTGCAGG + Intergenic
1056261884 9:84857002-84857024 CAGAGGAAGGAGCTGGGAACAGG - Intronic
1056875968 9:90331059-90331081 CCTAGGAAGTGGCAGGAAGATGG + Intergenic
1057037204 9:91820028-91820050 AAGAAGAAGGGGCAGTAAGAAGG + Intronic
1057044904 9:91878205-91878227 CAAGGGAAATGGCAGGAAGCAGG + Intronic
1057077632 9:92147259-92147281 CAGGGGAGAGGGCAGGAAGGAGG - Intergenic
1057194792 9:93110938-93110960 CGGAGGAAGGGGGAGAAAGTGGG - Intronic
1057442942 9:95095255-95095277 CAGAGGAAGGGACAGGAAACTGG - Intergenic
1057478690 9:95426944-95426966 CAGAAGCCGGGGCAGGAACCAGG - Intergenic
1057515112 9:95714186-95714208 GAAAGGAAGGGGAAGGAAGCAGG + Intergenic
1057605748 9:96496776-96496798 CAGAGGAAGGAGCTGGAGGAAGG - Intronic
1057841090 9:98486065-98486087 CAGGAGAAGGGGAGGGAAGCAGG - Intronic
1058433035 9:104935942-104935964 AAGAGGATGGAGGAGGAAGCAGG - Intergenic
1059072454 9:111152930-111152952 AGGAGGAAGGAGGAGGAAGCAGG + Intergenic
1059302725 9:113328055-113328077 CAGAAGAAGGAGAAGCAAGCTGG + Intronic
1059325921 9:113503981-113504003 AAGGGGAAGGGGGAGGAGGCAGG - Intronic
1059588813 9:115635251-115635273 CAGAGGAAGGAGCAGTAGGTGGG - Intergenic
1059766262 9:117386619-117386641 AAGGGGCAGGTGCAGGAAGCAGG + Intronic
1059777362 9:117488910-117488932 CAGCTGATGGGGCAGGAAGGAGG + Intergenic
1059990626 9:119862014-119862036 CAGAGGAAAACACAGGAAGCAGG - Intergenic
1060074637 9:120580215-120580237 CAGAGGACGGGCAGGGAAGCGGG + Intergenic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1060702114 9:125764160-125764182 CAGGGGGAGGGGCAGGAAAAAGG - Intronic
1060977024 9:127770866-127770888 AAGAGCATGGGCCAGGAAGCTGG + Intronic
1061063877 9:128265556-128265578 CAGGGGACGGGGCAGGCAGTTGG + Intronic
1061130135 9:128703798-128703820 CAGAGGAAGGGGGTGGGAGGGGG - Intronic
1061145282 9:128794117-128794139 AAGAGGAGGAGGCAGCAAGCTGG + Intronic
1061255876 9:129454032-129454054 CAGAGGAAAGGGCAGGTGGTTGG + Intergenic
1061291044 9:129650454-129650476 GAGAGGCAGAGGCAGGAAGGAGG + Intergenic
1061340228 9:129974298-129974320 CACAGGAAGGTGCAGTGAGCTGG - Intronic
1061433843 9:130548162-130548184 CAGGGGCAGGGGAAGAAAGCAGG - Intergenic
1061619663 9:131803647-131803669 CAGAGGTAGGAGGAGGGAGCAGG + Intergenic
1061651032 9:132050159-132050181 CAGGAGAAGGGACAGTAAGCAGG + Intronic
1061669310 9:132179735-132179757 GAGAGGAAGGTGCAGGGAGGTGG + Intronic
1061950135 9:133931499-133931521 CAGAGGACAGGGAAGGCAGCTGG - Intronic
1062066299 9:134528349-134528371 GAGAGGGAGGGTGAGGAAGCAGG + Intergenic
1062083259 9:134635667-134635689 CTGATGGAGGGCCAGGAAGCAGG - Intergenic
1062110508 9:134779727-134779749 CAGAGGTTTGGGGAGGAAGCAGG - Intronic
1062283248 9:135761362-135761384 CAGAGAAAGGAGCAGAATGCAGG - Intronic
1062344592 9:136109063-136109085 GAGAAGCAGGGGCAGGAGGCAGG - Intergenic
1062436108 9:136547195-136547217 CAGAGGCAGGCACAGAAAGCAGG + Intergenic
1062521297 9:136959052-136959074 CAGGGGACGGGGCTGGGAGCTGG + Intergenic
1062555468 9:137111822-137111844 CAGAGCTCGGGGCAGAAAGCAGG + Intronic
1062722848 9:138053532-138053554 CACAGGGAGGGGCCGGAAGCAGG - Intronic
1186114900 X:6294933-6294955 CAGTGGAACAGGCAGTAAGCAGG + Intergenic
1186740254 X:12509579-12509601 CAGAGGAAAGAGTGGGAAGCAGG + Intronic
1186993007 X:15089204-15089226 CAGAGGAACGATCAGGCAGCAGG + Intergenic
1187100858 X:16189881-16189903 TGGAGGAAGGTTCAGGAAGCAGG + Intergenic
1187600012 X:20818746-20818768 CGGGGGAAAGGGCAGGAAGGGGG + Intergenic
1188310658 X:28612542-28612564 TAAAGGGAGGGGCAGGAAACAGG + Intronic
1188545858 X:31306039-31306061 CAGAGGAAGTCCCAGGTAGCTGG + Intronic
1188718957 X:33499846-33499868 CAGATGATGGTGCAGGCAGCTGG + Intergenic
1189133915 X:38529493-38529515 CAAAGGGTGGGGCAGGAACCTGG + Intronic
1189240324 X:39519719-39519741 CCGAGGCGGGGGCAGGGAGCCGG - Intergenic
1189269365 X:39740137-39740159 CAGAGGAAGAGGCAGGGGCCCGG - Intergenic
1189758845 X:44300311-44300333 CAGAGGATGAGGCAGCAAGAGGG + Intronic
1189833831 X:45001122-45001144 TAGAGGAAGGTGCAGGCAGTAGG + Intronic
1190121396 X:47662348-47662370 CAGAGCTGGGGGCAGGAAGTTGG - Intergenic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190311800 X:49122272-49122294 CAGGAGAAGGGGCAGGTGGCGGG + Intronic
1190821312 X:53975710-53975732 CAGAGGCTGGGAAAGGAAGCGGG + Intronic
1191678366 X:63815426-63815448 CAGAGGAAGGTGAAGGAAAATGG - Intergenic
1191690363 X:63932880-63932902 GAGATGAAGGGGCAAGAGGCTGG - Intergenic
1191865089 X:65697505-65697527 AAGAGGAAGGGGCAGTGAGGAGG - Intronic
1192080237 X:68040760-68040782 CAGAGCCAGGGGCAGAAAACAGG - Intergenic
1192091225 X:68158651-68158673 CAGGGGAAGGGGGAGGGAGCAGG - Intronic
1192446778 X:71216817-71216839 CAGGGGAAGGGGAAGAGAGCTGG + Intronic
1192448957 X:71230897-71230919 AAGGGGAAGGGGAAGGAAGAGGG + Intergenic
1192528221 X:71866376-71866398 CAGAGCAAGGAGCAGAAGGCTGG - Intergenic
1192541312 X:71975575-71975597 CAGGGGAAGGGGCAGGGAATGGG - Intergenic
1193582675 X:83285171-83285193 CAGAGGAATGATCAGGCAGCAGG - Intergenic
1194481589 X:94433011-94433033 TAGAGGCTGGGGCAGGGAGCAGG + Intergenic
1195045305 X:101050036-101050058 CAGAGGAGGGACAAGGAAGCTGG + Intronic
1195086346 X:101417944-101417966 TTGGGGAAAGGGCAGGAAGCTGG + Intergenic
1195168917 X:102247019-102247041 GAGGGGGAGGGGCAGGAATCTGG + Intergenic
1195189940 X:102440067-102440089 GAGGGGGAGGGGCAGGAATCTGG - Intronic
1195353733 X:104018741-104018763 CTGAGGAAGGGTCTGGAGGCAGG + Intergenic
1195355287 X:104033700-104033722 CTGAGGAAGGGGCAGGAAGGAGG + Intergenic
1195708201 X:107753247-107753269 GGGAGGAAGGGCCAGGATGCTGG + Intronic
1195846806 X:109237826-109237848 TAGAGGCAGGTGCAGGCAGCAGG + Intergenic
1196554325 X:117069748-117069770 CGGGGGAAGGGGGAGGAAGCTGG + Intergenic
1196750905 X:119116441-119116463 CAGGGGAAGAGGCAGGCAGTTGG - Intronic
1196820841 X:119699098-119699120 CAGAGGGAGTGGTAGGAAGAGGG + Intergenic
1197199472 X:123735210-123735232 CAGAGGAGTGGGAGGGAAGCAGG - Intergenic
1197827441 X:130605324-130605346 GAGAGGAAAGGCCAGGAAGGTGG - Intergenic
1198060879 X:133044378-133044400 CAGAGGCATGGGCGGGAACCGGG + Intronic
1198225670 X:134642911-134642933 CAGAGAAAGGGAGAGGAAGAAGG + Intronic
1198885131 X:141327221-141327243 AAGTGGTAGGGGCAGCAAGCCGG + Intergenic
1198928145 X:141822517-141822539 CACAGGAAGGGGCTTGAAACTGG + Intergenic
1199270680 X:145879437-145879459 CAGAGTAAGTGGCAGGCAGTTGG + Intergenic
1199612941 X:149633103-149633125 CAGAGGATGGGAAAGGAAGATGG - Intergenic
1199627594 X:149755129-149755151 CAGAGGATGGGAAAGGAAGCTGG - Intergenic
1199743791 X:150759210-150759232 AAGAGGAAGGTGCTGGAAGGGGG - Intronic
1199861331 X:151802498-151802520 CAGAGGAAGGTGCTGGCTGCTGG - Intergenic
1199976556 X:152897978-152898000 CAGAGGAAGGGGCCGGCCGAGGG + Intergenic
1200074874 X:153545966-153545988 GAGAGGACGGGGCATGAAGAAGG + Intronic
1200119614 X:153784144-153784166 GAGAGGATGGAGCAGGAGGCAGG - Exonic
1201341804 Y:12942323-12942345 AAGGGGAAGGGGCAAGAAGAAGG + Intergenic
1201458997 Y:14201603-14201625 AAGAGGAAGAGGGAGGAAGGAGG + Intergenic
1201788919 Y:17816457-17816479 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1201812634 Y:18089530-18089552 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202334211 Y:23789816-23789838 CAGAGGAGAGGGCAGGGGGCGGG + Intergenic
1202350525 Y:23985532-23985554 CAGAGGAGAGGGCAGGTGGCTGG + Intergenic
1202520254 Y:25684589-25684611 CAGAGGAGAGGGCAGGTGGCTGG - Intergenic
1202536557 Y:25880243-25880265 CAGAGGAGAGGGCAGGGGGCGGG - Intergenic