ID: 902816453

View in Genome Browser
Species Human (GRCh38)
Location 1:18919166-18919188
Sequence CTGTGGGTGGGGGGAGCTGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1225
Summary {0: 1, 1: 1, 2: 9, 3: 152, 4: 1062}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902816453_902816461 -10 Left 902816453 1:18919166-18919188 CCAACAGCTCCCCCCACCCACAG 0: 1
1: 1
2: 9
3: 152
4: 1062
Right 902816461 1:18919179-18919201 CCACCCACAGATACTTAGAGGGG 0: 1
1: 0
2: 1
3: 8
4: 116
902816453_902816467 21 Left 902816453 1:18919166-18919188 CCAACAGCTCCCCCCACCCACAG 0: 1
1: 1
2: 9
3: 152
4: 1062
Right 902816467 1:18919210-18919232 TGTCAAAAAGACACGCGCACTGG 0: 1
1: 0
2: 0
3: 17
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902816453 Original CRISPR CTGTGGGTGGGGGGAGCTGT TGG (reversed) Intronic
900326560 1:2111139-2111161 AGGTGGGTGCTGGGAGCTGTGGG + Intronic
900500650 1:3002926-3002948 CTCTGGGTGGGCGGAGGTCTGGG - Intergenic
900503384 1:3017318-3017340 AGGTGGGTGGGGGGTGCTGGCGG + Intergenic
900515196 1:3078443-3078465 CGGGGGTTGGGGTGAGCTGTTGG - Intronic
901756850 1:11446691-11446713 CCTTGGATGGGGGCAGCTGTTGG - Intergenic
901823880 1:11847968-11847990 CTGAGGGTCTGGGGGGCTGTTGG - Intronic
902044122 1:13512874-13512896 GTCTGGGTGGGAGGAGCCGTGGG - Intronic
902133255 1:14281972-14281994 CTGTAGGTGTGGGGAGCTGGGGG - Intergenic
902551259 1:17220956-17220978 CTGTGGCTGGGAGCAGCTGGTGG + Intronic
902816453 1:18919166-18919188 CTGTGGGTGGGGGGAGCTGTTGG - Intronic
903058229 1:20651721-20651743 CTGTGGGTGGGGGTTGCTGTGGG - Intergenic
903818064 1:26079547-26079569 CTGTGGGGGTGGGGAGCGGCAGG - Intergenic
904037146 1:27565018-27565040 CTGGGGGTGGCTGGAGCTGGGGG + Intronic
904338128 1:29810998-29811020 CTGTGGGTGGGGCTGGCTTTGGG + Intergenic
904429313 1:30451749-30451771 CTGGTGGGGGGGGGAGCTGGGGG + Intergenic
904469241 1:30725838-30725860 GTTGGGGTGGGGGGAGCAGTTGG - Intergenic
904617525 1:31757982-31758004 CTGAGGATGGGGGGAGCTGCAGG + Intronic
905036757 1:34923700-34923722 CTGTGGGTGCTGGGAGGTGGTGG - Intronic
906033957 1:42739647-42739669 CTGTGGGAGGGGAGGGCTCTAGG - Intronic
906477096 1:46176492-46176514 GTGTGCCTGGGGGGTGCTGTTGG + Intronic
906524894 1:46488303-46488325 GGGGGGGTGGGGGGAGCAGTGGG - Intergenic
906653071 1:47527159-47527181 CTCGGGATGGGGGGAGTTGTGGG - Intergenic
906726653 1:48049142-48049164 GTGTGGGTGGAGGCAGCTGGAGG - Intergenic
907287163 1:53389357-53389379 CTGGGGGTGGGGGGAAGTGTGGG + Intergenic
907332736 1:53681806-53681828 CTGTGGGTGGGTGGAGCAACTGG + Intronic
907450706 1:54543964-54543986 TTGTGTGTGTGTGGAGCTGTTGG + Intronic
907953596 1:59207029-59207051 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
908598225 1:65711141-65711163 CTGGGGGATGGGGCAGCTGTGGG - Intergenic
910177255 1:84443615-84443637 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
910351911 1:86307801-86307823 GTGTGGGTTAGGGGAGCTGTTGG + Intergenic
910799577 1:91131770-91131792 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
912621991 1:111170615-111170637 CCATGGGTGGGGTGAACTGTTGG - Intronic
912658482 1:111508183-111508205 GTGTGGGTGGGGGGGTCTGGTGG - Intronic
912894821 1:113575785-113575807 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
913413541 1:118579530-118579552 CCGGGGGTGGGGGGAGGTGTGGG - Intergenic
914069934 1:144277357-144277379 CTGGGGGTGGGGGGGGGTGGGGG - Intergenic
914109221 1:144688997-144689019 CTGGGGGTGGGGGGGGGTGGGGG + Intergenic
914300951 1:146376703-146376725 CTGGGGGTGGGGGGGGGTGGGGG + Intergenic
914917565 1:151827919-151827941 ATGTGGGTGGGGGGAGTAGGGGG - Intronic
915073756 1:153292929-153292951 CTGTGGGTGGTGGGTGTGGTGGG - Intergenic
915084900 1:153379751-153379773 CTTTGAGTGGGCGGAGCTGGGGG - Intergenic
915164622 1:153941771-153941793 ATGTGGGTGGGGGGAGGGCTGGG - Intronic
915168799 1:153963561-153963583 GTGGGGGAGGGGGGAGCTATGGG - Intronic
915940759 1:160116783-160116805 CTGTGCCTAGGGGGAGCCGTGGG + Intronic
916379721 1:164195981-164196003 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
916502896 1:165401665-165401687 CTGTGAATGAGGGGAGCTGAGGG - Intronic
916625545 1:166552014-166552036 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
917163091 1:172080218-172080240 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
917650275 1:177069489-177069511 CAGTTGGGGGTGGGAGCTGTGGG + Intronic
917915267 1:179694895-179694917 CTGGAGGAAGGGGGAGCTGTGGG + Intergenic
918042071 1:180919561-180919583 CAGGGGGTGGGGGCAGCTGCAGG - Intronic
918102333 1:181387189-181387211 CTGTGAGTGGGGTGAGGTGGAGG + Intergenic
918360344 1:183751157-183751179 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
918417165 1:184322460-184322482 CTGGGGATGGGGGGAGGTGGCGG - Intergenic
918492033 1:185091394-185091416 GTGAGGCTGAGGGGAGCTGTAGG + Intronic
919599044 1:199600012-199600034 CTGTAGGAAGGGGCAGCTGTGGG + Intergenic
919680111 1:200425809-200425831 GGATGGGTGGGGGGAGCTATCGG + Intergenic
919817064 1:201448310-201448332 CTGTGTGTGCTGGGAGCTGCCGG - Intergenic
919855225 1:201701259-201701281 TTGTGGGGGTGGGGAGCTGGGGG + Intronic
920112579 1:203597768-203597790 CTGTGTGTGGGGGTGGCTGTGGG - Intergenic
920116529 1:203625524-203625546 CAGGGGGTGGTGTGAGCTGTTGG + Intergenic
920364288 1:205439996-205440018 CTTAGGGTGGGGGGACCTCTAGG - Intronic
920385835 1:205569595-205569617 CGGTGGGTGGGGGAAGCAGGTGG - Intronic
921122208 1:212147057-212147079 CTGTGGGTGTGGGGTACAGTAGG - Intergenic
921313150 1:213865281-213865303 TTGTGGGGGGGGGGAGCTTTTGG - Intergenic
922176709 1:223202843-223202865 TTGTGCGTGGGGGGAGGAGTGGG + Intergenic
922195886 1:223360252-223360274 CTGGGGGTGGGGGGCACTCTGGG + Intronic
922432441 1:225569320-225569342 CTTGGGGTGTGGGGAGCTGGGGG + Intronic
922474800 1:225899435-225899457 CTGTGGGTGGGTGGGGGTGGGGG - Intronic
922536631 1:226385894-226385916 CTGAGGGTTGGGGGCGCTGCAGG - Intronic
922617857 1:226973673-226973695 CTGAGGCTGGGGGCAGCTGGAGG + Intronic
922707381 1:227796529-227796551 CTGTGGGTGGGGCCGGCAGTAGG - Intergenic
922716062 1:227872733-227872755 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
923132870 1:231092444-231092466 ATGGGGGTGGGGGGGGCGGTGGG + Intergenic
924258189 1:242203253-242203275 CTGTGGGATGGGGAAGCCGTAGG - Intronic
924567065 1:245207756-245207778 GTGTGTTTGGGGGGAGCTGTGGG - Intronic
924580954 1:245323942-245323964 ATGTGGGTGGTGGGAGGTGGAGG + Intronic
924647221 1:245889406-245889428 CAGTGGGTGTGGGCAGCTGTGGG - Intronic
924787255 1:247210374-247210396 CACTGCGTGGGAGGAGCTGTGGG - Intergenic
1062831352 10:608159-608181 GTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831375 10:608228-608250 GTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831412 10:608358-608380 CTGTGTGTGGGGGGGGCTGTGGG - Intronic
1062831435 10:608418-608440 GTGTGTGTGGGGGGGGCTGGGGG - Intronic
1062908386 10:1195274-1195296 CTGAGGATGGTGGGAGATGTTGG - Intronic
1062921584 10:1284470-1284492 CTGTGGGTGGAGGCAGCCATCGG - Intronic
1062933691 10:1369380-1369402 CTGGGGGTGAGGGGACCTGGGGG + Intronic
1063040492 10:2332643-2332665 CAGTGGGAGGTGGGAGCTGAGGG - Intergenic
1063302941 10:4868415-4868437 TTGTGGGTGGGGAGAAGTGTAGG + Intergenic
1063463977 10:6231569-6231591 CTGTGGGTGCCGGAAGCTGTGGG + Intronic
1064542012 10:16414805-16414827 CGGGAGGTGGGGGGAGCTGGGGG - Intergenic
1065075950 10:22079884-22079906 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1065876321 10:30000356-30000378 CTGTGTGTGGAGGCAGCTGGTGG - Intergenic
1066629979 10:37449775-37449797 CGGGGGGTGGGGGTAGCGGTAGG + Intergenic
1067261737 10:44698991-44699013 CTGTGTGAGAGGGGAGCTCTGGG + Intergenic
1067332220 10:45333219-45333241 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1067574631 10:47401478-47401500 CTGTGGGTGCTGGGAAATGTGGG + Intergenic
1067824150 10:49557605-49557627 CTGTGGGTGGGGGCTCCTGCAGG - Intergenic
1068357054 10:55923102-55923124 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1068469907 10:57448073-57448095 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1069550521 10:69360721-69360743 CTCTGGGTGCGGGGAGTGGTGGG + Intronic
1069708273 10:70472803-70472825 CTGGGGGAGGGAGGAGGTGTGGG + Intergenic
1070603107 10:77879296-77879318 CTGTGGGTGGAGGGACCTGGAGG + Intronic
1070917987 10:80167135-80167157 CTGTGGGCTGGGGTAGCTGGGGG - Intronic
1071228783 10:83562335-83562357 CTGTGGGTAGTGGCAGCTTTGGG - Intergenic
1072199940 10:93149317-93149339 CAGTGGGTGGGGGAAGCTGCTGG - Intergenic
1072359017 10:94640498-94640520 CTGTGGGTTGCGAAAGCTGTGGG + Intergenic
1072795861 10:98354008-98354030 CTGTTAGTGGAGGGAGCTGACGG + Intergenic
1073059495 10:100724798-100724820 CTGTGGGAGTTGGGAGCTGGGGG - Intergenic
1073073105 10:100807281-100807303 CTGTGGGTGAGGGGAGCAGGTGG - Intronic
1073600110 10:104838396-104838418 CTGTGAGTGGTGGGAGAGGTCGG + Intronic
1073735118 10:106336542-106336564 CCGTGGCTGGGGTGAGCTTTGGG - Intergenic
1073807218 10:107110611-107110633 GTGGGGGTGGGGGGAGTTGGTGG - Intronic
1074016706 10:109542166-109542188 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1074901218 10:117817802-117817824 CAGTGCTTGGGGGGAGTTGTTGG - Intergenic
1075779741 10:125009482-125009504 CTGAGGGTGGTGGGATCGGTGGG - Intronic
1076061676 10:127418311-127418333 CTGGGAGTGGAGGCAGCTGTGGG + Intronic
1076242335 10:128917741-128917763 CTGAGTGTGGGAGGAGCTGAAGG - Intergenic
1076724524 10:132407264-132407286 TTCTGGGTGGGGGCAGCTGGTGG + Intronic
1076861199 10:133139239-133139261 CTGTGGTTGGGGGGGTCTCTGGG + Intergenic
1076871525 10:133197259-133197281 CTGTGGGTGGGTGCATCTGGGGG + Intronic
1076878309 10:133227713-133227735 CTGAGGGTTGGGGGTGCTGGGGG - Intergenic
1077117036 11:889877-889899 CAGAGGGGGAGGGGAGCTGTGGG - Intronic
1077133067 11:984244-984266 CTGTGGTCGGGGGGCCCTGTGGG + Intronic
1077254297 11:1573481-1573503 CTGGGGGTGGGGAGTACTGTGGG + Intergenic
1077393367 11:2309830-2309852 CTGGGGGTGGGGGGAGCTCAAGG + Intronic
1077456849 11:2686472-2686494 GTGAGGGTGGGGGTATCTGTTGG - Intronic
1077469628 11:2751083-2751105 CTGTGGGGTGCGGGGGCTGTGGG - Intronic
1077561995 11:3270007-3270029 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1077567889 11:3315827-3315849 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1077654749 11:4007822-4007844 CTGTGAGTGGTGAGAGCTGTGGG + Intronic
1078336407 11:10466586-10466608 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1078392849 11:10951859-10951881 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1078498359 11:11842369-11842391 CGGTGGGTGCGGCGAGCAGTTGG + Intronic
1078809372 11:14743159-14743181 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1079129891 11:17741207-17741229 AGGGGGGTGGGGGGAGCTGGAGG - Intronic
1079241288 11:18723991-18724013 CGTTGGGTGGGGGTTGCTGTTGG + Intronic
1079492939 11:21009933-21009955 CAGTGGGTGGGGGGAGGGGGAGG - Intronic
1080275281 11:30496710-30496732 CGGGGGGTGGGGGGAGGTGAGGG + Intronic
1080878122 11:36295161-36295183 CAGTGTGTGGCGGGAACTGTGGG - Intergenic
1081118331 11:39232609-39232631 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1081492372 11:43578691-43578713 ATAGGGGTGGGGGGAGCGGTCGG + Intronic
1081713578 11:45233407-45233429 CTGTGGGGGTGGGGAGAGGTAGG - Intronic
1081758173 11:45559365-45559387 AGGTGGGTGGAGGGAACTGTGGG - Intergenic
1081809629 11:45907654-45907676 GGGTGGGGGGGGGGTGCTGTAGG - Intergenic
1082826755 11:57585504-57585526 CTGTGGCTGGGGGCTACTGTGGG - Intergenic
1083296631 11:61718717-61718739 CTGAGGGTGGGGGGAGGAGTAGG + Intronic
1083656566 11:64232629-64232651 CTGGGGGTGGGGCAAGCTGAGGG - Intronic
1083679680 11:64345341-64345363 CTGTGTGATGGGGGCGCTGTGGG + Intronic
1083795285 11:65013587-65013609 CTCTGGGTGGGGGCAGCCTTTGG + Intergenic
1083899497 11:65636743-65636765 CTGGGGGAGGGGGGAGAGGTTGG - Intronic
1084403147 11:68956331-68956353 CTGTGGTGGGGGGGGGGTGTTGG + Intergenic
1084422002 11:69065176-69065198 CTGTGGGTGGTGGGGGCAGCTGG + Intronic
1084544155 11:69805685-69805707 CGGTGGGTGCTGGGAGCTGGGGG - Intergenic
1084597076 11:70123307-70123329 GTTTGGGTGGGGGCAGCCGTGGG + Intronic
1084847560 11:71912307-71912329 CTCTGGGTGGGTGGAGATCTGGG + Intronic
1085174022 11:74471201-74471223 CTGAGGGCAGCGGGAGCTGTGGG - Intergenic
1085347588 11:75778258-75778280 CTGTGGTTGGGGGAAACTGCTGG - Intronic
1085503941 11:77045238-77045260 CAGTTGGTGGGTAGAGCTGTAGG - Intergenic
1085795236 11:79533219-79533241 CTGTGGCTGGGGGGAGAAGTGGG + Intergenic
1086129251 11:83383514-83383536 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1086392923 11:86384308-86384330 CTGTGGGGGTGGGGAGGAGTGGG + Intronic
1087297100 11:96389951-96389973 CTCTGGGTGGGGCGAGGGGTGGG + Intergenic
1087326318 11:96727719-96727741 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1088034580 11:105296346-105296368 CTGTGGGAAGGGGTGGCTGTGGG - Intergenic
1088066507 11:105726437-105726459 CTGGGGGGAGGGGCAGCTGTGGG + Intronic
1088469277 11:110176485-110176507 CCGTGGCTGGGGGGAGCAGGAGG - Intronic
1088476002 11:110240374-110240396 AAGTGGGTGGGGGGAGTTGAAGG + Intronic
1088595407 11:111437122-111437144 CTGAGGGTGGGGGCTGCTGGGGG - Intronic
1088689784 11:112315866-112315888 ATGTGGGTGGGGAGAGGTGCTGG + Intergenic
1088833137 11:113555071-113555093 TTGGGGGTGGGGGGTGGTGTGGG - Intergenic
1089133297 11:116229299-116229321 TTGTGGGTGAGGGGAGCCGCAGG - Intergenic
1089285422 11:117404748-117404770 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1089504818 11:118956243-118956265 CTGGGGGTGGGAGGGGCTGGAGG - Intronic
1089665402 11:120014730-120014752 ATGTGTGTGGGAGGAGCTGTGGG - Intergenic
1090105651 11:123851733-123851755 CTGGGGGTGGGGGCAGCAGACGG + Intergenic
1090408826 11:126493721-126493743 CTGTGGGTGAGGGGGGCTGTAGG - Intronic
1090464881 11:126925097-126925119 CGGGGGGGGGGGGGGGCTGTTGG + Intronic
1091168508 11:133501097-133501119 GTGTGGGTGGTGGGAGCAGGGGG - Intronic
1091311840 11:134580454-134580476 CTGTGGGTGGGGAGCTCTGAGGG + Intergenic
1091408013 12:220991-221013 CTGGGGGTGGCGGGAGCCGAGGG + Exonic
1091810315 12:3391466-3391488 CTGTGTGTGGGACGAGCAGTGGG + Intronic
1092217460 12:6693309-6693331 CTGTGGGTGGGGGCAGGTTAGGG + Intergenic
1092290689 12:7158084-7158106 CTCTGCGTGGGGAGAGGTGTAGG - Exonic
1092628907 12:10358121-10358143 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1092703304 12:11256891-11256913 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1092829370 12:12429030-12429052 ATGTGGGTGAGTGGAGCTGCCGG + Intronic
1093004473 12:14036321-14036343 CTGGGGGAAGGGGTAGCTGTAGG + Intergenic
1093530839 12:20161194-20161216 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1095406395 12:41871075-41871097 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1095488540 12:42708737-42708759 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1095778924 12:46037424-46037446 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1096069250 12:48765798-48765820 GTGTGCACGGGGGGAGCTGTGGG + Intergenic
1096244627 12:49977324-49977346 TTGTGGGTGTGAGGGGCTGTGGG + Intronic
1096623637 12:52879799-52879821 GGGTGGGTGGGGGGAGCTGAGGG - Intergenic
1096642731 12:53006946-53006968 GTGTGGTGGGGGGGAGCAGTTGG + Intronic
1096741560 12:53697345-53697367 CTGGGGATGGGGGGAGATGGGGG + Intergenic
1096785805 12:54016632-54016654 CGGTGGGTGGGGGTAGGGGTGGG + Intronic
1097153277 12:56994930-56994952 CTGGGGGTGGGGAGAAATGTTGG + Intronic
1097187850 12:57205114-57205136 CAGTGGGTGGTGTGGGCTGTGGG - Exonic
1097299117 12:57998675-57998697 GTTTGGGTGGCTGGAGCTGTGGG + Intergenic
1097435514 12:59548980-59549002 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1097458801 12:59834369-59834391 GTGGGGGTGGGGGGACCTGGTGG - Intergenic
1097898749 12:64853084-64853106 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1098174236 12:67774359-67774381 CTGGGGGTGGGGGCAGATATTGG + Intergenic
1098186922 12:67906545-67906567 CTGGGGGTTTGGGGAGATGTTGG - Intergenic
1098704651 12:73671944-73671966 CTGTGGGGAGGGGCGGCTGTGGG + Intergenic
1098780211 12:74676929-74676951 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1099435217 12:82634755-82634777 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1099486202 12:83232404-83232426 CTGTGGGAAGGGTCAGCTGTGGG - Intergenic
1099494992 12:83335755-83335777 ATGGGGGTGGGGTGGGCTGTAGG + Intergenic
1100073879 12:90755079-90755101 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1100874571 12:98948762-98948784 GTGTGTGTGGGGGGGGGTGTGGG - Intronic
1101206543 12:102493979-102494001 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1101332990 12:103772050-103772072 CTGTGGGTGGGGGGAGATGGGGG + Intronic
1101472854 12:105014954-105014976 CTGTGAGTGGGCAGAGCTGATGG + Intronic
1101541262 12:105667579-105667601 CTGTGGGTGAGAGGCTCTGTGGG - Intergenic
1102345525 12:112158788-112158810 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1102582974 12:113903213-113903235 CTGTGGTTGGTGGAATCTGTGGG + Intronic
1102766614 12:115439212-115439234 CAGTGGGTGGAGGGACTTGTGGG - Intergenic
1103057667 12:117834431-117834453 CTGGGGGTGGGGGGCGGGGTAGG + Intronic
1103067990 12:117915870-117915892 TTCTGGGTGTGGGGAGCTGGTGG - Intronic
1103948417 12:124539515-124539537 CTGTGGGTGGACTGAGCTGGTGG - Intronic
1104414845 12:128589492-128589514 CTGTGGGGAGGGGGAGGTGCAGG - Intronic
1104656083 12:130574963-130574985 CTGGGGGTGGGGGTGGCGGTGGG - Intronic
1104765699 12:131328554-131328576 CTGTCTGTGGGGGGAGGTGTGGG - Intergenic
1104813566 12:131633306-131633328 CTGTCTGTGGGGGGAGGTGTGGG + Intergenic
1104964657 12:132503457-132503479 CCCTGGGCGGGGGGAGATGTGGG + Intronic
1105578938 13:21675669-21675691 CTGTAGGTGGGGGGTGCGGTGGG + Intronic
1106295312 13:28408290-28408312 GTGTGGGATGGGGGAGGTGTGGG - Intronic
1106312115 13:28563418-28563440 CTGTGGGTGGGAAGACCTGTTGG + Intergenic
1106326289 13:28693654-28693676 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1106361838 13:29038636-29038658 CTGGGGGATGGGGCAGCTGTGGG - Intronic
1106429477 13:29666118-29666140 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1106456994 13:29936229-29936251 GTGTGGGTGTGGAGAGCAGTGGG + Intergenic
1106623882 13:31398573-31398595 CTGTGGGTAGGGCATGCTGTGGG - Intergenic
1107011315 13:35673790-35673812 GGGTGGGAGGGGGGAGCGGTGGG - Intergenic
1107400209 13:40062128-40062150 GTGAGGGTGGGGGAGGCTGTAGG - Intergenic
1107473408 13:40712462-40712484 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1107648217 13:42516832-42516854 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1107816760 13:44251323-44251345 CTGGGGGTGGGGGGACCTTGAGG - Intergenic
1108007232 13:45961556-45961578 ATGTGGGGGTGGGGAGATGTGGG + Intronic
1108048761 13:46408687-46408709 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1109163388 13:59003864-59003886 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1109541294 13:63782032-63782054 CTGAGGGAAGGGGCAGCTGTGGG - Intergenic
1110019999 13:70457850-70457872 CTGAGGGAAGGGGCAGCTGTGGG + Intergenic
1110120193 13:71870208-71870230 CGGGGGGTGGGGGGGGTTGTGGG - Intergenic
1110408625 13:75179125-75179147 GTGTGGGTGGGGGGGGCGGCGGG + Intergenic
1111084856 13:83362521-83362543 CGGAGGGGGGGGGGAGCTGGGGG - Intergenic
1111481138 13:88828253-88828275 GTGTGTGTGTGAGGAGCTGTTGG - Intergenic
1111927388 13:94478151-94478173 CTGGGGGTGGGGGGGGCGGGCGG - Intronic
1112151975 13:96773722-96773744 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1112165900 13:96919262-96919284 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1112546466 13:100376444-100376466 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1112646157 13:101334356-101334378 ATGGGGGTAGGGGGAGCGGTAGG + Intronic
1113400236 13:109985808-109985830 CTGTGAGTGGGGGTGGCTATGGG - Intergenic
1113499725 13:110763858-110763880 CCATGGGTGTGGGGAGCTGTGGG + Intergenic
1113722834 13:112573791-112573813 GTGGGGGTGGGGGGATCTGGAGG - Intronic
1114083489 14:19220435-19220457 CTGTGGGCTGGGGGAGCAGCTGG + Intergenic
1114472404 14:22972866-22972888 CTGGGGTTTGGGGGAGCTGGAGG + Exonic
1114567835 14:23645477-23645499 GTGTGGGTCTGGGGAGCTGAAGG + Exonic
1115008130 14:28511365-28511387 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1115348376 14:32366456-32366478 CTGTGGGTGGGATGAGTTGTGGG + Intronic
1115359754 14:32488123-32488145 CTGGGGGAAGGGGTAGCTGTGGG - Intronic
1115673618 14:35644762-35644784 CTGTTGGTGGGGGAAGGTGAGGG + Intronic
1115940283 14:38601411-38601433 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1116085805 14:40236535-40236557 CTGTGCATGGAGGGAGCAGTTGG - Intergenic
1116775772 14:49179022-49179044 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1116869535 14:50058062-50058084 CTGTGGGTCAGGGGAGGTGGGGG + Intergenic
1117710747 14:58526105-58526127 CTGTGGGAAGGGGCGGCTGTGGG + Intronic
1118764209 14:68899299-68899321 CTGTGGGTGTGGTGTGCTGTGGG - Intronic
1119092979 14:71801602-71801624 TGGTGGGTGGGGGGAGCAGAGGG + Intergenic
1119379279 14:74218371-74218393 GTGGGGGTGGAGGGGGCTGTTGG + Intergenic
1119409613 14:74422221-74422243 ATGGGGGTGGGGGCAGCTGCAGG + Intronic
1119730517 14:76948175-76948197 CTGTGGGTGAGGGGAGGTGAGGG - Intergenic
1120077717 14:80178891-80178913 CTGTAGTTGGTGGCAGCTGTAGG + Intergenic
1120682230 14:87494051-87494073 CTGTGTATGGAGGGAGCTTTGGG - Intergenic
1120713582 14:87817535-87817557 TGGTGGGTGGTGGGAGCAGTAGG + Intergenic
1121292344 14:92786222-92786244 CTGTGGGTTGGGGGCTCTCTGGG + Intergenic
1122207359 14:100154660-100154682 CTGTGGGTGCAGGGGGCTTTGGG - Intronic
1122412697 14:101534020-101534042 CTGGGGGTGGGGGGGGCACTGGG + Intergenic
1122437861 14:101711815-101711837 CGGTGGGTGGGGTGAGATATCGG - Intergenic
1122437881 14:101711887-101711909 CGGTGGGTGGGGAGAGATGATGG - Intergenic
1122437887 14:101711907-101711929 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122437893 14:101711927-101711949 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437899 14:101711947-101711969 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122437927 14:101712022-101712044 CGGTGGGTGGGGAGAGATGGTGG - Intergenic
1122437934 14:101712042-101712064 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437940 14:101712062-101712084 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437946 14:101712082-101712104 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122437955 14:101712118-101712140 CAGTGGGTGGGGTGAGATCTCGG - Intergenic
1122437977 14:101712198-101712220 CGGTGGGTGGGGAGAGATGATGG - Intergenic
1122437988 14:101712238-101712260 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122437999 14:101712278-101712300 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438010 14:101712318-101712340 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122438021 14:101712358-101712380 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438027 14:101712378-101712400 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438043 14:101712438-101712460 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438054 14:101712478-101712500 CGGTGGGTGGGGTGAGATCTTGG - Intergenic
1122438060 14:101712498-101712520 CGGTGGGTGGGGTGAGATCTCGG - Intergenic
1122438076 14:101712558-101712580 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438091 14:101712614-101712636 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438106 14:101712670-101712692 CGGTGGGTGGGGTGAGATGATGG - Intergenic
1122438112 14:101712690-101712712 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438118 14:101712710-101712732 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438124 14:101712730-101712752 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438136 14:101712770-101712792 CGGTGGGTGGGGTGAGATCTTGG - Intergenic
1122438146 14:101712806-101712828 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438152 14:101712826-101712848 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438158 14:101712846-101712868 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438164 14:101712866-101712888 CGGTGGGTGGGGTGAGATCTCGG - Intergenic
1122438170 14:101712886-101712908 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438176 14:101712906-101712928 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438182 14:101712926-101712948 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122438198 14:101712982-101713004 CGGTGGGTGGGGAGAGATCTCGG - Intergenic
1122438215 14:101713054-101713076 CGGTGGGTGGGGTGAGATCTCGG - Intergenic
1122438221 14:101713074-101713096 CGGTGGGTGGGGGGAGATGACGG - Intergenic
1122438229 14:101713094-101713116 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122438242 14:101713146-101713168 CAGTGGGTGGGGTGAGATCTCGG - Intergenic
1122438302 14:101713382-101713404 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438313 14:101713422-101713444 CGGTGGGTGGGGAGAGATGACGG - Intergenic
1122438319 14:101713442-101713464 CGGTGGGTGGGGGGAGATGACGG - Intergenic
1122438327 14:101713462-101713484 CAGTGGGTGGGGGGAGATGACGG - Intergenic
1122438340 14:101713502-101713524 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438346 14:101713522-101713544 CGGTGGGTGGGGTGAGATGACGG - Intergenic
1122438352 14:101713542-101713564 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438366 14:101713594-101713616 CAGTGGGTGGGGTGAGATCTCGG - Intergenic
1122438382 14:101713654-101713676 CAGTGGGTGGGGTGAGATGACGG - Intergenic
1122438391 14:101713690-101713712 CGGTGGGTGGGGTGAGATCTCGG - Intergenic
1122438397 14:101713710-101713732 CAGTGGGTGGGGAGAGATGACGG - Intergenic
1122633811 14:103120999-103121021 CTGCAGGTGGAGGGTGCTGTTGG + Intergenic
1122677673 14:103430368-103430390 CTGGGGGTGGGGGAAGATGGGGG - Intronic
1122792510 14:104190245-104190267 CTGTGGGTTTGGGGATCTGGGGG + Intergenic
1122887817 14:104718326-104718348 GTCTGGGTGGCGGGAGCTGTTGG + Intronic
1122953074 14:105056561-105056583 GTGTGGGGTGGGGGAGCCGTAGG - Intronic
1122955194 14:105067163-105067185 CCTTGGGTGGCAGGAGCTGTGGG + Intergenic
1123401916 15:19995681-19995703 ATGTGTGTGGGGGGATCAGTGGG - Intergenic
1123578087 15:21693116-21693138 ATGTGTGTGGGGGGATCAGTGGG - Intergenic
1123614712 15:22135598-22135620 ATGTGTGTGGGGGGATCAGTGGG - Intergenic
1124211735 15:27770075-27770097 CTGGGGGTGGGGGGCACTGCAGG - Intronic
1124222890 15:27865245-27865267 GTGTAGGTGGGGAGAGCTGGCGG - Intronic
1124819421 15:33029790-33029812 CTGTGGTTTGGGAGAACTGTGGG + Intronic
1124999067 15:34753033-34753055 CTGGGGGTGGGGGCAGTGGTGGG - Exonic
1125288569 15:38120268-38120290 CTGGGGGAAGGGGGAGCTGTGGG + Intergenic
1125884787 15:43220641-43220663 CTGTGGGGGGGGGGTGTGGTAGG - Intronic
1125892221 15:43275268-43275290 CTCTGGGATGGGGGAGCTATTGG + Intergenic
1126663104 15:51051755-51051777 CTTTGGGTTGGGGGAGATGAGGG - Intergenic
1128052731 15:64677905-64677927 CTGTGGGTGGGTGCAGAGGTGGG + Intronic
1128252278 15:66171760-66171782 CTGGGGGTGGGGGGAACTGGAGG - Intronic
1128782753 15:70373739-70373761 CGGTTGGTGGGGAGAGCTGGGGG + Intergenic
1128799760 15:70489940-70489962 CTGTAGGGGTGGGGAGCTGAGGG + Intergenic
1128831911 15:70777220-70777242 CTGTGGGTGGAGAGGGTTGTGGG + Intergenic
1129151824 15:73693895-73693917 CGGTGGGTGGGGGGAGGGGCAGG + Intronic
1129181183 15:73876903-73876925 CTGGGGGTGGGAGGGGCAGTGGG - Intronic
1129559680 15:76553081-76553103 TAGGGGGTGGGGGGTGCTGTGGG - Intronic
1129673175 15:77618162-77618184 TGGCGGGTGGGGGGAGCTGCTGG + Intronic
1129706226 15:77796038-77796060 CTGTGGGTGCCGGAGGCTGTGGG + Intronic
1130012204 15:80160556-80160578 CTGCTGGTGGGGGGAGATGGAGG + Intronic
1130393807 15:83483735-83483757 CTGTTGGTAGGGGCATCTGTAGG + Intronic
1130441973 15:83963552-83963574 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1130460920 15:84157816-84157838 CTGTGGGTCAGGGGAGGTGGAGG + Intergenic
1131065706 15:89433777-89433799 CTCTGGGTGGGGGCAGGTGCTGG + Intergenic
1131094053 15:89645112-89645134 CTGTGGCAGGGGGGACCTGGCGG + Exonic
1131139268 15:89963912-89963934 CTGTGGGAGGGCAGAGCAGTGGG - Intergenic
1131174396 15:90201123-90201145 CAGTGGGGGCGGGGAGCTGGGGG + Intronic
1131174733 15:90202286-90202308 CTGCGGATGGGGGCAGCTCTGGG + Intronic
1131174745 15:90202342-90202364 CTGCGGATGGGGGCAGCTCTGGG + Intronic
1131278419 15:91001618-91001640 CTGTGGGTGGGGAGAAGGGTGGG - Intronic
1132096472 15:98988536-98988558 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1132347342 15:101116263-101116285 CTGGGGGAGGGTGGAGCGGTGGG - Intergenic
1202986957 15_KI270727v1_random:427361-427383 ATGTGTGTGGGGGGATCAGTGGG - Intergenic
1132704478 16:1237178-1237200 CTCTGGGAGGAGGGAGCTGGAGG + Intergenic
1132707036 16:1249247-1249269 CTCTGGGAGGAGGGAGCTGGAGG - Intergenic
1132944200 16:2523618-2523640 CTCTGTGTGGGGAGGGCTGTGGG - Intronic
1133190587 16:4130891-4130913 CTGTGGATGGTGGGAACTGATGG + Intergenic
1133428601 16:5715711-5715733 CTGAGGTTGGGGGCAGCTTTGGG + Intergenic
1133645841 16:7763765-7763787 CTAAGGGTGGGGGGAGGTGTAGG + Intergenic
1133698148 16:8284533-8284555 CAGGGGGTGGGGGGAGCTGCTGG + Intergenic
1133994811 16:10740250-10740272 GTCTGGGTGGGTGGATCTGTGGG + Intergenic
1134115411 16:11544162-11544184 CTGTGTATGGGGGGATATGTAGG - Intergenic
1135150874 16:20004678-20004700 CTGAGGGTCGGGGGAGCAGGGGG - Intergenic
1135381261 16:21997941-21997963 CTCTGGCTGTGGGGAGCTGGAGG + Intronic
1135992071 16:27224343-27224365 CAGTGGGTGGGGGGAGGCGGTGG + Intergenic
1136016093 16:27402118-27402140 CTGCGGGTGGGCGGGGCTGGCGG + Intergenic
1136116313 16:28097150-28097172 CTGGGGAAGTGGGGAGCTGTGGG - Intergenic
1136504473 16:30694102-30694124 CTGTGTGTAATGGGAGCTGTTGG - Intergenic
1137222703 16:46471657-46471679 CAGTGGGTGGGGGGTGGTATTGG + Intergenic
1137531491 16:49281479-49281501 CTGGGGGTGGGGGGCGGGGTGGG - Exonic
1137606037 16:49787530-49787552 CTGGGAGTAGTGGGAGCTGTGGG - Intronic
1138198761 16:55073696-55073718 CAGTGGGGGGGGGGGGGTGTAGG + Intergenic
1138550429 16:57744697-57744719 GTGTGGGTGGGGGGATGTGCGGG + Intronic
1138551882 16:57752946-57752968 CTGTGGGAGTGGGGGGCGGTGGG - Intronic
1139514050 16:67443044-67443066 CTGTCGGTGGGTGGGGCTGTGGG - Intronic
1140046653 16:71443936-71443958 CTGTGGATGTGGGGGTCTGTGGG + Intergenic
1140083931 16:71777306-71777328 CAGAGGGTGGGGGGAGCGGGAGG + Intronic
1140666591 16:77233793-77233815 ATGTGGGTGGGGGGGGCTGGGGG - Intergenic
1140923995 16:79565503-79565525 TTGTGGGGGGGGGGACCAGTTGG + Intergenic
1141561033 16:84867905-84867927 CAGTGGCTGGGGGGAGCTGAAGG - Intronic
1141754512 16:85982461-85982483 TTGTGGTTGGGGGGAGCGGCTGG + Intergenic
1142228615 16:88889066-88889088 CTGAGGCTGGGGGCATCTGTTGG + Intronic
1142285324 16:89169317-89169339 CTGGGGGTGGGGGGACCTCTGGG + Intergenic
1142356039 16:89602515-89602537 CGGTGGGTGGGGGGGGCAGCTGG + Intergenic
1142525409 17:536854-536876 CTTTGTGTGTGGGGAGGTGTCGG + Intronic
1143060424 17:4196031-4196053 GTGTGGGTGGGGGGTGGTGGGGG - Intronic
1143328931 17:6120112-6120134 TGGTGGGTGGGGGCAGCTCTGGG - Intronic
1143351111 17:6288941-6288963 CTGAGGGTTTGGGGAGCTGGAGG + Intergenic
1143400449 17:6639457-6639479 CTGTGGAGGGGAGAAGCTGTGGG - Intronic
1143498048 17:7323613-7323635 CTGTGTGTGTTGGGGGCTGTTGG - Intronic
1143660680 17:8322734-8322756 CTGTGGTTGGGGGCTGCTGCAGG + Intergenic
1144584185 17:16477933-16477955 CTGTGGGTGGGAGTGGCGGTGGG + Intronic
1144710668 17:17399553-17399575 GTGTGGGTGGGGGCAGGGGTGGG - Intergenic
1146022731 17:29293228-29293250 GTCTCGGTGGGGGGGGCTGTTGG - Intronic
1146056081 17:29581881-29581903 GTGTGGGTGGGTGGGGGTGTGGG - Intronic
1146267042 17:31459738-31459760 CTTTGGGTGGGGGGAGGGGCTGG - Intronic
1146561195 17:33871878-33871900 CTCTGGGTGGGGTGAGGTTTTGG + Intronic
1147042876 17:37731626-37731648 CTGGTGGTGGGGGGAGCCGTGGG + Exonic
1147430376 17:40367058-40367080 ATGTGGGTTGGGGGCGCTGCTGG + Intergenic
1147525314 17:41216713-41216735 CTGTGGGGTGGGGCAGCTGTGGG + Intronic
1147704244 17:42414972-42414994 CAGTGGGAGGGGAGAGGTGTAGG - Intronic
1147909582 17:43847393-43847415 CTGGGGGTGGGGGGAGGTGGGGG + Intronic
1147983143 17:44287739-44287761 CAGTGGATGGGTGGAGCTGGGGG - Intergenic
1148158996 17:45439421-45439443 CTGTGGGTGTGGGGAAGGGTGGG + Intronic
1148354852 17:46968987-46969009 CTGTGGTGGGGGGCAGGTGTCGG - Intronic
1148699749 17:49580254-49580276 CTGTGGGTGGGGGGAGGGGAGGG + Exonic
1148838587 17:50479761-50479783 CGGTGGGTAGTGGGGGCTGTAGG + Exonic
1149365509 17:55939522-55939544 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1149542011 17:57474513-57474535 CTGGGGGTGGGGGATGCTATTGG - Intronic
1150141584 17:62734295-62734317 GGGTGGGTGTGGGGAGCTGAAGG + Intronic
1150631865 17:66885518-66885540 CTGGGCTTGGGGGGAGCTGCTGG - Intergenic
1150643714 17:66965541-66965563 CTGGGGTTGGGGGGAGCGGACGG + Intronic
1151007575 17:70455684-70455706 CAGTGGGTGGGGAGAGGGGTAGG - Intergenic
1151064137 17:71131588-71131610 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1151186849 17:72371126-72371148 TTGTGGGTGGGAGGAGCGGATGG - Intergenic
1151196755 17:72437237-72437259 CTGTGGGTGGTGGGACTTGGGGG - Intergenic
1151445188 17:74159119-74159141 CTGTGGGCAGGGGGAGCACTGGG - Intergenic
1151774846 17:76193535-76193557 CCGTGGGTGGGGGGTGGTGGGGG - Intronic
1152044799 17:77928953-77928975 CTGGGGGAGGGGGGATCGGTGGG - Intergenic
1152253232 17:79222663-79222685 CTGTGTGTGGGGGGACATGGAGG - Intronic
1152264646 17:79287306-79287328 CTGTGGGTGGGGAGTGCTATGGG - Intronic
1152527693 17:80898661-80898683 CGGGGGGTGGGGGGAGCGGGGGG - Intronic
1152624016 17:81380077-81380099 GTGGGGGTGGGGGGAGCGGGGGG - Intergenic
1152639820 17:81444803-81444825 AAGTGCGTGGGGGGCGCTGTGGG - Exonic
1152639841 17:81444850-81444872 CTGTACTTGGGGGGTGCTGTTGG + Intronic
1152649386 17:81484787-81484809 CTCTGGGTTGGGGGTGCTGGGGG + Intergenic
1152721550 17:81926355-81926377 CTGTAGGTGGTGGGAGCTTCAGG - Intronic
1152911883 17:83009935-83009957 CTGTGGGGGAGGGGGGCTGTGGG + Intronic
1152911890 17:83009951-83009973 CTGTGGGGGAGGGGAGCTGTGGG + Intronic
1152912487 17:83013341-83013363 CTGGGGGTGGGCGGTGCTGGGGG - Intronic
1153562193 18:6382908-6382930 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1153596258 18:6728711-6728733 CTGTTGGTGGGGGACGATGTAGG - Intergenic
1153643442 18:7174730-7174752 GTGTGGGTGTGGGGTGCTGAAGG - Intergenic
1153995139 18:10434150-10434172 CTGTGGGTTGGGGGGGGTGGTGG - Intergenic
1154166322 18:12017272-12017294 CTGGGGGTGGCGGGAGCTGGTGG - Intronic
1155077041 18:22367797-22367819 GTGTGTGTGGCGGGAGCTGGGGG + Intergenic
1155173002 18:23280944-23280966 CTGGGGGTGGGGAGAGGCGTGGG - Intronic
1156188326 18:34689740-34689762 CTGGGGGAGGGGGCAGCTGTGGG - Intronic
1156460418 18:37318622-37318644 GTGGGGGGGGGGGGAGGTGTAGG - Intronic
1156582412 18:38393100-38393122 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1156626822 18:38919849-38919871 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1157298767 18:46464726-46464748 GGGAGGATGGGGGGAGCTGTAGG - Intergenic
1157421991 18:47555292-47555314 CTGTGGGTGGCAGGAGAGGTGGG - Intergenic
1157481128 18:48054405-48054427 CCGTGGGGGGTGGCAGCTGTGGG + Intronic
1157894948 18:51457075-51457097 GGGTGGGTGGGGAGAGCTGAGGG - Intergenic
1157946934 18:51991023-51991045 GTCTGGGTGGAGGGAGCTGAGGG + Intergenic
1157961219 18:52155356-52155378 ACGTGGGTGGGGGGAGATGGAGG - Intergenic
1158987264 18:62830666-62830688 TTGTCGGTTGGTGGAGCTGTGGG + Intronic
1159460708 18:68719592-68719614 TTGGGGGTGGGGGGAGGTGGGGG - Intronic
1159661182 18:71097720-71097742 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1159821258 18:73147614-73147636 CAGTGAGTGGTGGGAGCTGTTGG - Intergenic
1160001830 18:75032108-75032130 CTCAGTGTGGGGGGAGCTCTCGG - Intronic
1160078830 18:75703886-75703908 CTGGGGGTGCAGAGAGCTGTGGG + Intergenic
1160472290 18:79146599-79146621 CTGCGTGTCGGGGGAGCTGGCGG + Intronic
1160494004 18:79358891-79358913 CTCTGTGTGAGGGGTGCTGTGGG + Intronic
1160798671 19:957106-957128 CTGTGGGTGGGGGGGGGCGCTGG + Intronic
1160808525 19:1002995-1003017 CTGGGGCTGGGGGGAGGTGGAGG + Intronic
1160820306 19:1054757-1054779 CTGTGTGTGAGGGGAGATGTAGG - Intronic
1160842140 19:1150942-1150964 CTGTGCAGGGGAGGAGCTGTGGG - Intronic
1160866717 19:1259482-1259504 CTGTGGCTGGGGAGAGCTGGTGG - Exonic
1160871837 19:1281294-1281316 CTCTGGGTGGGGGGGGGTGGGGG + Intergenic
1160979816 19:1811783-1811805 CTGTGGGACGGGGGAGAGGTGGG + Exonic
1161209030 19:3056788-3056810 CTTGGGGTGGGGGTAGCTGCTGG - Intronic
1161282998 19:3455918-3455940 CTGGGGTTGGGGGGAGCTGGAGG - Intronic
1161546204 19:4881898-4881920 CTGTGGGTGGCCGAGGCTGTCGG - Intergenic
1161589117 19:5120841-5120863 CTGTGGCTGGGGGCAGCCCTTGG - Intronic
1161646033 19:5453992-5454014 CTGTGGGAGGGGAGAGAAGTGGG + Intergenic
1161666216 19:5578627-5578649 CTGGAGGTGGGGGAAGCCGTGGG - Intergenic
1161702692 19:5804156-5804178 CTGTGGGAGCGCGGAGCCGTCGG + Intergenic
1161788073 19:6340572-6340594 CTGTGTGTGGGTGGAGCAGATGG + Intergenic
1161808697 19:6459457-6459479 CTGGGGGTGGGGGTACCTGTTGG + Exonic
1162182080 19:8876708-8876730 GGGTGGGTGGGGGGTGGTGTGGG + Intronic
1163001767 19:14372632-14372654 CTGTGGGGGTGGGGAACTGGTGG - Intergenic
1163064557 19:14783727-14783749 CTGTGGGGGTGGGGAACTGGTGG + Intergenic
1163129038 19:15260601-15260623 CAAGGGGTGGGGGGTGCTGTAGG - Intronic
1163221222 19:15922577-15922599 CTGTGGGTGGTGGGCTCTGATGG - Intronic
1163311665 19:16518717-16518739 CGGTGGGTGCGGGGAGCTGGAGG + Exonic
1163498882 19:17663655-17663677 TTTGGGGTGGGGGGAGCAGTTGG - Intronic
1163528290 19:17834722-17834744 CTGAGGGTGAGAGGAGCAGTCGG + Intronic
1163548166 19:17951328-17951350 CTGTTGGAGGGGGCAGCTGAAGG + Exonic
1163817078 19:19473212-19473234 CTGTGGGAGGGGGCAGCACTTGG + Intronic
1163989926 19:20988714-20988736 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1164442499 19:28290049-28290071 CTCTGGGTGGGGGGAGATGGAGG - Intergenic
1164477196 19:28584961-28584983 CTGAGGCTGGGGGGACCTCTGGG + Intergenic
1164562501 19:29302201-29302223 CTGGGGGTGCTGGGAGCTGTGGG + Intergenic
1164579965 19:29428967-29428989 CTGAGGGTGGGCAGAGCAGTAGG + Intergenic
1164617604 19:29676223-29676245 CTGTGGGTGGTGGTAGCGGCAGG - Intergenic
1164672156 19:30078286-30078308 CTGTGCGTGAAGGGAGCTGCCGG + Intergenic
1164924644 19:32120057-32120079 CCGTTAGTGGGGGAAGCTGTAGG + Intergenic
1164995929 19:32720363-32720385 GTGTGGGTTGGGGGAGGAGTGGG - Intronic
1165856258 19:38880737-38880759 CTGTGGGGAGGGGGAGCTAAGGG + Intronic
1165938526 19:39403515-39403537 CTGTGGGTTTGGGGAGGTGGAGG + Intergenic
1166277342 19:41763185-41763207 CTGTGGGTGGGTGGTGGTGATGG - Intronic
1166304717 19:41931181-41931203 CTGGGGGTGGGGGGTGCTGAGGG - Intergenic
1166324744 19:42042366-42042388 CTGTGCCTGGCGGGTGCTGTGGG - Intronic
1166359573 19:42247615-42247637 CTGAGGGTGGGGGGAGTAGAGGG - Exonic
1166391474 19:42411096-42411118 CTGAGGGAGGAGGGAGCTGAGGG - Intronic
1166766251 19:45253176-45253198 GTGTGTGTGGGGGGGTCTGTCGG - Intronic
1166991763 19:46697080-46697102 CTGGGGGTAGGAGGAGGTGTGGG + Intronic
1167352236 19:48982635-48982657 CTGGGGGAGGGGGCAGCTGGGGG - Intronic
1167354356 19:48994010-48994032 CTGAGGGAGGGGGGATCTGGGGG + Intronic
1167374015 19:49101759-49101781 CTGGAGGTGGGGGGAGGGGTCGG + Intronic
1167586948 19:50380705-50380727 CTGAGGTTGGGGAGAGCTGGTGG + Intronic
1168415289 19:56163954-56163976 ATATTGGTGGGGAGAGCTGTTGG - Intergenic
1168519193 19:57035187-57035209 CTGAGGGTGAGGGGTGCTCTCGG - Intergenic
1202715220 1_KI270714v1_random:38668-38690 TGGTGGGGGGGGGGGGCTGTGGG - Intergenic
925146662 2:1587190-1587212 CTGTGGGTGGGGCCAGGGGTGGG - Intergenic
925450060 2:3961567-3961589 GTGTGGGTGGGAGGATGTGTGGG - Intergenic
926193509 2:10745698-10745720 CTGTGGGTGGAGGGTGGTGACGG - Intronic
926728126 2:16014334-16014356 CGGTGGGGTGGGGGAGCTGGTGG - Intergenic
926907477 2:17819517-17819539 GTGTGGGTGGCGGGAGGGGTGGG - Intergenic
927132621 2:20073284-20073306 CTGAGGGAGGTGGGAGATGTGGG - Intergenic
927518274 2:23684729-23684751 CTGTGGGTGGGGGCGGGTGCTGG - Intronic
927719414 2:25373215-25373237 CTGGGATTGGGAGGAGCTGTGGG + Intergenic
928112072 2:28518749-28518771 CTGTGGGTGGATGGTGTTGTGGG + Intronic
928200854 2:29246814-29246836 CTGGAGGTGGGGAGAGCAGTTGG - Intronic
928265302 2:29806266-29806288 CTGTCAGTGGGGAGAGGTGTGGG + Intronic
928435695 2:31253229-31253251 GTGTGGGAGGGGGTTGCTGTGGG - Intronic
928819468 2:35343073-35343095 CTGTGGGAGGGTGGCCCTGTGGG - Intergenic
929090118 2:38207777-38207799 CAGTGGGTTGGGGGAGGTGATGG - Intergenic
929476106 2:42250736-42250758 GGGTGGGTGGGGGGAGGTGTTGG + Intronic
929536024 2:42784511-42784533 CTGGGGGTGGGGGGAGGTGGGGG + Intronic
929906596 2:46051363-46051385 CTGTGAAGGTGGGGAGCTGTGGG + Intronic
930444424 2:51451936-51451958 ATGTTGTTGGGGGGAGCTGGCGG + Intergenic
930752909 2:54949446-54949468 CTGTGGCTGAGGGGAGTTGAGGG + Intronic
930764753 2:55073912-55073934 CTGAGGGAGGGTGGTGCTGTGGG - Intronic
931212045 2:60206926-60206948 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
931235728 2:60410920-60410942 CTGTGGGTGGGGGGGGGGGGGGG + Intergenic
931479100 2:62621983-62622005 CTGTGGGAAGGGGCGGCTGTGGG - Intergenic
931573869 2:63699086-63699108 CTGTTTGTGGGAGTAGCTGTTGG - Intronic
931814883 2:65890498-65890520 CTGGGGGAAGGGGAAGCTGTGGG + Intergenic
931937318 2:67213771-67213793 GTGTATGTGGGGGGACCTGTGGG - Intergenic
932051523 2:68403322-68403344 CTGAGGGAAGGGGCAGCTGTGGG - Intergenic
932212070 2:69940113-69940135 CTTTGGGTGGGGGGAGGGGCAGG + Exonic
932467296 2:71932159-71932181 CTGTGTGAGGGGGGATCTGGGGG - Intergenic
932620759 2:73263901-73263923 GGGTGGGTGGTGGGTGCTGTTGG - Intronic
932646739 2:73510809-73510831 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
932691985 2:73921158-73921180 CTGTGGGTGGGGTGGGATGGAGG + Intergenic
933070533 2:77852336-77852358 ATGTGGGTGGGGGGTGCGGGGGG + Intergenic
933166584 2:79083353-79083375 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
933744203 2:85558900-85558922 TTCTGGGTGAGGGGAACTGTGGG - Exonic
934536693 2:95140128-95140150 CAGTGGGTGAGGGGAGCTGAGGG + Intronic
934988051 2:98901421-98901443 CTCTGGATGGGGGGAGCCCTGGG - Intronic
935154770 2:100474328-100474350 CTGTGGGTTGGGGGAGGTGAGGG - Intronic
937273480 2:120669995-120670017 ATGTGGGAGGGGGGAGGTGAAGG - Intergenic
937339125 2:121079774-121079796 CTTGGGGTGGGGGGATCTGGGGG + Intergenic
937762962 2:125627794-125627816 CTGTGCATGGGGAAAGCTGTTGG - Intergenic
937797386 2:126039940-126039962 GTGTGGGCAGGGGGAGCTGGGGG - Intergenic
937913961 2:127089917-127089939 CCCTGGGTGGGGGGAGCAGGGGG - Intronic
938087116 2:128408864-128408886 CTGTGGTTAGGGTGGGCTGTGGG + Intergenic
938168095 2:129050243-129050265 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
938789328 2:134662943-134662965 CTGTGGCTGGTGGGAACTGGTGG - Intronic
939937719 2:148313247-148313269 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
940417775 2:153442640-153442662 CTGGGGGAAGGGGCAGCTGTAGG - Intergenic
940838098 2:158547949-158547971 CTGAGGCTGGGTGAAGCTGTTGG + Intronic
941571460 2:167175733-167175755 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
941715587 2:168760082-168760104 CTGGGGTTGGGGGGATCTGAGGG - Intronic
941781664 2:169452330-169452352 CTGTGGGTGGGGGTAGGGGTGGG - Intergenic
943082996 2:183279090-183279112 CTGTGCCTGATGGGAGCTGTGGG - Intergenic
943723066 2:191225394-191225416 CTGGGGGTGGGGGAAGCATTTGG - Intergenic
944106690 2:196086486-196086508 CTGCGGGTGGGAGGAGGTGGTGG + Intergenic
944242081 2:197496444-197496466 GTGAAGGTGGGGGGAGCTATTGG - Intronic
944267955 2:197748780-197748802 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
945042087 2:205750986-205751008 GTGTGGGTGGGGGACACTGTTGG + Intronic
945210838 2:207380801-207380823 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
945666763 2:212753312-212753334 CTGAGGGAAGGGGCAGCTGTGGG + Intergenic
945928355 2:215829222-215829244 GTGTGGTTGGGGGGACCTGGTGG - Intergenic
945999859 2:216473102-216473124 CTGGGGGTGGGGGCAGCGGGTGG - Intronic
946182805 2:217959068-217959090 CTGTGCGGGGAGGGGGCTGTTGG + Intronic
946432840 2:219634731-219634753 AGGGTGGTGGGGGGAGCTGTTGG + Intronic
947049886 2:226030642-226030664 CTGTGTGTGGGGGGTGGGGTGGG + Intergenic
947133533 2:226954576-226954598 GTGGGGGTCGGGGGAGCAGTGGG - Intronic
947311528 2:228808934-228808956 CTGTGGGGAGGGGCAGCTGTGGG - Intergenic
947364730 2:229381823-229381845 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
947491913 2:230602734-230602756 CTGGGGGTGGGTGGGGGTGTGGG - Intergenic
947791148 2:232870166-232870188 GTGTTGGTGGGGGGAGCGGGGGG + Intronic
947875896 2:233468142-233468164 CTGCTGGTGGGTGGTGCTGTTGG + Intronic
947912174 2:233808660-233808682 CTCTGAGTGGGAGGAGATGTTGG - Intronic
948084838 2:235238809-235238831 CTGTGTGTGGGTGGGGCTGCTGG + Intergenic
948228535 2:236332820-236332842 CTGTGGGTGAGCTGAGCTGCTGG + Intronic
948315568 2:237026042-237026064 TTGGGGGTGGGGTCAGCTGTGGG + Intergenic
948359799 2:237412229-237412251 CTGGGGGTGGAGGGCGCTGAAGG - Intronic
948600753 2:239106327-239106349 CTGGGGGTGGGGGCACATGTAGG + Intronic
948800327 2:240430527-240430549 CTGGGGGTGGGGGGGGTTGGGGG - Intergenic
948846904 2:240687610-240687632 CTGTGGGTGGGGGGTGCACACGG + Intergenic
948869243 2:240790027-240790049 GTGTGGGTGGGAGGAGCTCCTGG - Intronic
948904759 2:240973550-240973572 CTGGGGATGTGGGGAGCTGGGGG - Intronic
948934014 2:241150582-241150604 CAGCGGGCGGGGGGAGCTGCGGG + Intronic
948995050 2:241573798-241573820 CTGTGTGTGGGGGCACCTGAGGG - Exonic
949040943 2:241849772-241849794 CTGTGTGTGGAGGGTGCTGGTGG - Intergenic
1168997404 20:2143680-2143702 CTGTGTGTGCTGGGGGCTGTGGG - Intronic
1169396998 20:5241314-5241336 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1170445441 20:16422467-16422489 CTATGGGTGGTGGGAGCTCCAGG + Intronic
1170808798 20:19657374-19657396 CTGTGGGTGAGGGAAGATGTTGG - Intronic
1171022879 20:21602698-21602720 CTGTGGGTAGGGAGGGCTGGAGG + Intergenic
1171186166 20:23125872-23125894 CTGTGGCTGGGAGGAGCTCTGGG - Intergenic
1171562301 20:26136534-26136556 CAGTGGGTGGGGGAAGTTTTCGG + Intergenic
1171768289 20:29301791-29301813 CTGGGGGACGGGGGAGCTCTTGG - Intergenic
1173577648 20:44123403-44123425 CTGTGTGTAGGAGCAGCTGTAGG - Intronic
1173586562 20:44187168-44187190 CAGTGGGTGTGCGGGGCTGTCGG + Exonic
1173590542 20:44221464-44221486 CAGTGGCTGGAGGGAGCTGCAGG + Intergenic
1173866711 20:46317096-46317118 CTGTGGGTGTCGGCAGCTTTTGG + Intergenic
1174575947 20:51537247-51537269 GTGTGGGTGGGGGGTGCAGGGGG + Intronic
1175444926 20:59013396-59013418 CTGTGAGTGGAGTCAGCTGTGGG + Intergenic
1175488695 20:59364249-59364271 CTCTGAGTTGGGGGAGCTGCTGG - Intergenic
1175814662 20:61877223-61877245 CAGTGGGTGGGGAGATCTCTGGG - Intronic
1175938141 20:62524586-62524608 CTGGGGGAGGGGGGAGCTCCTGG - Intergenic
1175983286 20:62752193-62752215 CTGGGGGTGAGGGGAGGTGAGGG - Intronic
1176380091 21:6108001-6108023 CTGAGGGTGGAGGGGGCTGGGGG + Intergenic
1176891836 21:14327710-14327732 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1177042650 21:16132788-16132810 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1178486085 21:33020861-33020883 GTGTGGGATGGGGGAGCTGGAGG + Intergenic
1178590460 21:33905158-33905180 TTGGGGGTGGGGGGTGCTGGTGG + Intronic
1178663351 21:34524842-34524864 CTGTCGGTGGGGGCAGCTGGGGG + Intronic
1179562958 21:42228380-42228402 CTGTGGCTGGGGAGGGCAGTGGG - Intronic
1179614437 21:42572768-42572790 CTGTGGGTGCTGTGAGCTCTGGG + Intronic
1179743383 21:43430237-43430259 CTGAGGGTGGAGGGGGCTGGGGG - Intergenic
1179769717 21:43605642-43605664 TTGTGTGTGGGTGGAGATGTGGG - Intronic
1180157845 21:45986703-45986725 CTGTGGTTGGGGGCATCTGCCGG - Intronic
1180171040 21:46058368-46058390 CTGTGAGTGTGTGGACCTGTGGG - Intergenic
1180185023 21:46135229-46135251 CAGTTGCTGGGTGGAGCTGTGGG - Intergenic
1180294486 22:10872832-10872854 CTGTGGGCTGGGGGAGCAGCTGG - Intergenic
1180497292 22:15902246-15902268 CTGTGGGCTGGGGGAGCAGCTGG - Intergenic
1180596287 22:16975554-16975576 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1180699122 22:17772311-17772333 CTGTGAGTGGGAGGCCCTGTGGG + Intronic
1180800729 22:18630731-18630753 CTGTGTGTGGGAGGGGCTGTGGG - Intergenic
1180851962 22:19026288-19026310 CTGTGTGTGGGAGGGGCTGTGGG - Intergenic
1180929610 22:19579946-19579968 CTGTGGAGGGGGTGAGCTGGTGG + Intergenic
1181000928 22:19987385-19987407 CAGTGGGTGGGGGGAGGTGGTGG - Intronic
1181160657 22:20957783-20957805 CTGTGGGCCGGGGCAGCTGCGGG + Intergenic
1181572598 22:23775782-23775804 CGGTGGGTGATGGGAACTGTAGG + Intronic
1181586789 22:23857070-23857092 GTGTGGGGGGGGGGGGGTGTAGG + Intronic
1181638979 22:24187089-24187111 CTGTGGGTGAGGGCACCTGCAGG - Intronic
1181688499 22:24545081-24545103 CTGTGGGCAGGGGGAGCTCTAGG + Intronic
1182080772 22:27527106-27527128 CTGCGGGTGGGAGGACCTGGTGG + Intergenic
1182288203 22:29260241-29260263 TTGGGGGTGGGGGGAGAAGTGGG + Intronic
1182547783 22:31085661-31085683 CTGTGTAAGGAGGGAGCTGTGGG - Intronic
1182654503 22:31879304-31879326 CTGGGGGTGGGAGGAGGAGTTGG - Intronic
1183240750 22:36656614-36656636 CTGAGCGTCGTGGGAGCTGTTGG - Intronic
1183327651 22:37203170-37203192 CTGTGGGTTAGGGGAGCCATTGG - Intergenic
1183425327 22:37736001-37736023 CTGTGTCTGAGAGGAGCTGTAGG - Intronic
1183467387 22:37986537-37986559 ATGGGGGTGGGGGTAGCAGTGGG + Intronic
1184038380 22:41929111-41929133 GTGGGGGTGGGGGCAGGTGTGGG + Intergenic
1184120382 22:42446029-42446051 CTCTGGCTGGGGTGGGCTGTGGG + Intergenic
1184224608 22:43122087-43122109 CTGTGGGAGGGCGGCGCTGTGGG + Intronic
1184372486 22:44091401-44091423 CTGTGGGTGGGTGGTGGTGATGG - Intronic
1184550977 22:45204018-45204040 GTGTGGGCGGTGGGAGCTGATGG - Intronic
1184611677 22:45607838-45607860 CTCTGGGAGGGGGAAGATGTGGG + Intergenic
1184692307 22:46122876-46122898 CTGTGGGTGGAGGGGTGTGTAGG + Intergenic
1184730659 22:46369419-46369441 CTGGGTGTGGTGGGCGCTGTGGG - Intronic
1184735294 22:46394432-46394454 CTGTGGGTGGGGGGTGAGGTTGG - Intronic
1184858082 22:47157461-47157483 CTGTGGCTGGGGTCTGCTGTAGG + Intronic
1185056523 22:48581521-48581543 CTCTGGGCGCGCGGAGCTGTAGG + Intronic
1185339187 22:50284057-50284079 CGGTGGGTGGGGGGACAGGTGGG - Intronic
1185367997 22:50445745-50445767 CTGTGGGGTGGGGGAGGTGGCGG + Exonic
1185413670 22:50698399-50698421 CTGGGGGTGGGGGCAGCAGCAGG + Intergenic
949421757 3:3873297-3873319 GTGTGTGTGGGTGGAGGTGTGGG - Intronic
949440194 3:4071840-4071862 CTGAGGGAAGGGGCAGCTGTGGG + Intronic
949837019 3:8280349-8280371 CTGTAGTTGGGGGAAGCTGTGGG - Intergenic
949999756 3:9647901-9647923 CTGGGGGTGGGAGGAGTTGGGGG + Intergenic
950088468 3:10278206-10278228 ATGGGTGTGGGGGGAGCTGGGGG + Intronic
950664997 3:14489954-14489976 CAAAGGGTGGGGGGCGCTGTTGG - Exonic
951310962 3:21125401-21125423 CTGAGGGAAGGGGCAGCTGTGGG + Intergenic
951676390 3:25246916-25246938 CTGAGGGAAGGGGCAGCTGTGGG - Intronic
952972098 3:38657895-38657917 CTGGGGGTGGAGGGAGGTGTGGG + Intergenic
953133965 3:40166962-40166984 CTCTCTGTGGGGGGAGGTGTGGG + Intronic
953286694 3:41617146-41617168 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
953843190 3:46406437-46406459 CTGTGGGGAGGGGAGGCTGTGGG - Intergenic
954053126 3:47999098-47999120 CTGGGGGTGGAGGGAGGTGGTGG + Intronic
954451174 3:50572511-50572533 CTGTGGGTTGGGTGAGCCATGGG - Intronic
954531135 3:51320871-51320893 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
954876594 3:53806421-53806443 CGGTGGGTGGCAGGAGCTGGCGG + Intronic
955413727 3:58673099-58673121 CTGTGGGTGGGCAGAGGTGTAGG + Intergenic
955588683 3:60510707-60510729 GTGTGTGTGGGGGGAGGTGGGGG - Intronic
956355770 3:68390400-68390422 CTATGGGAAGGGGCAGCTGTGGG + Intronic
956910793 3:73814710-73814732 CTGGGGGTGGGGTCAGTTGTAGG + Intergenic
957776544 3:84761556-84761578 CTGAGGGAAGGGGAAGCTGTGGG + Intergenic
959025703 3:101237262-101237284 CTGGGGGAAGGGGCAGCTGTAGG + Intronic
959074597 3:101736243-101736265 CTGGGGGAAGGGGCAGCTGTAGG + Intronic
959278261 3:104304845-104304867 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
959747576 3:109795303-109795325 CTGGGGGAAGGGGCAGCTGTCGG + Intergenic
959801049 3:110495562-110495584 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
960177332 3:114532533-114532555 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
960226867 3:115179209-115179231 CTGGGGGTAGGGGCAGCTGTGGG - Intergenic
960273152 3:115696572-115696594 TTGTGGGGGGGGGGGGCGGTGGG - Intronic
960378075 3:116927890-116927912 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
960491587 3:118322207-118322229 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
960619718 3:119626289-119626311 CTGTTGGTGGGGGAACCTGCAGG + Intronic
961361479 3:126370862-126370884 GTATGGGTGGGGGCAGCTGAGGG - Intergenic
961448666 3:126992627-126992649 CTGGGGGCGGGGGGTGCTGGTGG + Intronic
961456923 3:127028970-127028992 CTGGGGGAGGAGGGAGCTGGAGG - Intronic
961509054 3:127390158-127390180 CTGGGCTTGGGGTGAGCTGTGGG - Intergenic
961535908 3:127570387-127570409 CTCTGGGTGGGTGGACCTGCAGG + Intergenic
961813247 3:129533763-129533785 CTGTGGCTGGGGGAAGGTGTAGG - Exonic
962514051 3:136132010-136132032 CAGGGGGTGGGGGGGGCTGGGGG + Intronic
962744092 3:138384646-138384668 CTGTAGGAGGGGAGACCTGTGGG + Intronic
962797485 3:138861817-138861839 CTGTGGGAAGAGGGAACTGTAGG + Intergenic
963027497 3:140933934-140933956 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
963481395 3:145879308-145879330 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
963519284 3:146345121-146345143 ATGTGGGTGGGGGTAGCTGGAGG + Intergenic
963629248 3:147712755-147712777 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
963980299 3:151529251-151529273 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
963998511 3:151739608-151739630 CTGGGGGAAGGGGAAGCTGTGGG - Intronic
964010422 3:151885686-151885708 CTGGGGGAAGGGGAAGCTGTGGG + Intergenic
964221760 3:154354806-154354828 CTGTGCGTGGAGGGAGGTGGTGG - Intronic
964232534 3:154487328-154487350 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
964332639 3:155620806-155620828 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
964371320 3:156003683-156003705 CTGAGGGAAGGGGCAGCTGTGGG - Intergenic
964649037 3:158991165-158991187 CTGGGGGAAGGGAGAGCTGTAGG - Intronic
964710932 3:159670867-159670889 CTGTGGGTGGGTGGGTGTGTGGG + Intronic
964720352 3:159763784-159763806 CTCGGGGTGGGGGGCGCTCTCGG - Intronic
965091021 3:164163017-164163039 CTGGGGGTAGGGGCAGCAGTGGG - Intergenic
965278630 3:166720228-166720250 CTGTTGGGGGGTGGAGGTGTTGG - Intergenic
965640766 3:170826372-170826394 CTGGGGGCGGGGGGAGATGGGGG + Intronic
965881888 3:173396859-173396881 GTGGGGGTGGGGGGTGCTGGAGG + Intronic
966309469 3:178576888-178576910 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
966875494 3:184319585-184319607 CTGTGGGTGGTGAGAGGTTTTGG + Intronic
966891493 3:184410438-184410460 CTGGTGGTGTGTGGAGCTGTAGG + Intronic
967967459 3:194973465-194973487 CTGTGGGTGGGGTGGGATGGGGG - Intergenic
968453101 4:684265-684287 CAGTGGGGTGGGGCAGCTGTGGG - Intronic
968534469 4:1114116-1114138 GTGGGGGTGGGGGGGGCAGTTGG + Intergenic
968548917 4:1212652-1212674 CTGTGGGAGGAGGGGGCTTTGGG - Intronic
968605218 4:1532214-1532236 CTGCTGGTGGGGGCAGCTGAAGG + Intergenic
968614993 4:1573735-1573757 CTGAGGATGGGGGGAGCTGAGGG - Intergenic
968752054 4:2395444-2395466 CTGTGTGTGGGGAGAGCGTTGGG - Intronic
968825727 4:2895414-2895436 TGGTGGGTGGAGGGTGCTGTGGG + Intronic
968832151 4:2938173-2938195 CAGCGGGTGGGGGGAGCTGGAGG + Exonic
968982843 4:3860031-3860053 CTGGGGGTGCGGGGAGCTATGGG - Intergenic
968988556 4:3893328-3893350 CTCTGGGTGGGTGGAGGTCTGGG - Intergenic
969025145 4:4166917-4166939 CTCTGGGTGGGTGGAGATCTGGG - Intergenic
969099838 4:4760576-4760598 CTGTGGGTACTGGGATCTGTGGG - Intergenic
969266270 4:6066141-6066163 CTGTGGGTTGGGGGAGCTCTGGG - Intronic
969309654 4:6346026-6346048 CTGTGGTTGGTTTGAGCTGTGGG - Intronic
969311038 4:6353403-6353425 CTGTCGGTGTGGAGGGCTGTCGG - Intronic
969311068 4:6353487-6353509 CTGTCGGTGTGGGGGGTTGTTGG - Intronic
969311074 4:6353503-6353525 CTGTCGGTGTGGGGGGCTGTCGG - Intronic
969311080 4:6353519-6353541 CTGTTGGTGTGTGGGGCTGTCGG - Intronic
969311135 4:6353699-6353721 CTGTCGGTGTGGGGGGCTGTCGG - Intronic
969311141 4:6353715-6353737 CTGTTGGTGTGTGGGGCTGTCGG - Intronic
969311145 4:6353731-6353753 CTGTCGGTGTGGGGGGCTGTTGG - Intronic
969311151 4:6353747-6353769 CTGTCGGTGTTGGGGGCTGTCGG - Intronic
969311156 4:6353763-6353785 CTGTCGGTGTTGGGGGCTGTCGG - Intronic
969311161 4:6353779-6353801 CTGTTGGTGTGTGGGGCTGTCGG - Intronic
969311170 4:6353812-6353834 CTGTCGGTGTTGGGGGCTGTCGG - Intronic
969311175 4:6353828-6353850 CTGTCGGTGTTGGGGGCTGTCGG - Intronic
969311192 4:6353878-6353900 CTGTCGGTGTTGGGGGCTGTCGG - Intronic
969311197 4:6353894-6353916 CTGTCGGTGTTGGGGGCTGTCGG - Intronic
969311209 4:6353927-6353949 CTGTTGGTGTGGGGGGCTGTCGG - Intronic
969444711 4:7237990-7238012 CTGTGGGCCAGGGGTGCTGTTGG + Intronic
969694470 4:8726751-8726773 CTGTTGGTGGGGGGACCACTGGG - Intergenic
969793899 4:9510901-9510923 CTCTGGGTGGGTGGAGGTCTGGG + Intergenic
969873284 4:10117494-10117516 GTGGGGGATGGGGGAGCTGTCGG + Intergenic
969909139 4:10427666-10427688 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
970182332 4:13412352-13412374 CTGGGGGTGGGAGGAGAAGTGGG + Intronic
970867827 4:20779570-20779592 GTGTGGGGGGGGGGGGTTGTGGG - Intronic
971004542 4:22358092-22358114 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
973167034 4:47091043-47091065 CTGGGGGTGGGGGAAGGGGTGGG - Intronic
973562689 4:52152044-52152066 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
973613461 4:52658450-52658472 CTAAGGGTGGGGCGGGCTGTGGG - Intronic
974106198 4:57472469-57472491 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
974312897 4:60235035-60235057 CTGTGGGTGGGGGGGGGTCCAGG + Intergenic
974814008 4:66982286-66982308 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
975379464 4:73681542-73681564 GTGGGGGTAGGGGGAGATGTTGG + Intergenic
975458502 4:74622510-74622532 CTGGGGGTTGGGGGTTCTGTAGG - Intergenic
975620285 4:76290249-76290271 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
976221896 4:82762662-82762684 TTGTGGGTGGAGCGAGCTGGTGG + Intronic
976370857 4:84286477-84286499 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
976439333 4:85055313-85055335 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
976809894 4:89089673-89089695 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
977746756 4:100558535-100558557 CTGTTGGTGGGGGGCACGGTGGG + Intronic
977871407 4:102094670-102094692 CTGTGTGTGGGCTGATCTGTGGG - Intergenic
978186008 4:105858004-105858026 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
978313329 4:107409835-107409857 CTGGGGGACGGGGCAGCTGTGGG + Intergenic
978512990 4:109541796-109541818 CTGTGGGTGGGGGGTGGGGTGGG - Intergenic
978601366 4:110431760-110431782 CTGGGGGTAGGGGCAGCTATGGG - Intronic
979698244 4:123638850-123638872 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
980171242 4:129292535-129292557 CTGGGGGAAGGGGAAGCTGTGGG - Intergenic
980487791 4:133482567-133482589 CTGTGGGTGAGTGTAGGTGTGGG + Intergenic
980633869 4:135473542-135473564 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
981114802 4:140976992-140977014 ATGTGGGTGGGAGGGGGTGTGGG - Intronic
981133936 4:141189493-141189515 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
981305972 4:143247477-143247499 CTGGGGGTGGGGGGTGGTTTTGG - Intergenic
981671587 4:147293006-147293028 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
981940022 4:150271905-150271927 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
982601335 4:157454617-157454639 CTGGGGGTGGGGGGTGCTAGGGG - Intergenic
983237243 4:165193322-165193344 ATGTGGGTGGGGGGACATCTGGG + Intronic
983331340 4:166333335-166333357 CTGGGGGAAGGGGCAGCTGTAGG - Intergenic
983596265 4:169471720-169471742 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
984618700 4:181927568-181927590 CTGGGGGAAGGGGTAGCTGTGGG + Intergenic
985506790 5:286040-286062 CGGGGAGTGGGGGGAGCTGATGG + Intronic
985515908 5:344388-344410 CTGCGGGTGGGGAGGGCTGCGGG + Intronic
985531457 5:436147-436169 CTGGGAGTGGCAGGAGCTGTGGG + Exonic
985535992 5:466046-466068 GTGTGGGTGGGTGGAGCTCGAGG + Intronic
985620481 5:952355-952377 CTGTGGCTGTGGGTAGCTGTGGG + Intergenic
986082624 5:4410032-4410054 CAGGGGCCGGGGGGAGCTGTGGG + Intergenic
986685500 5:10272459-10272481 CTGTGGGTGGAGGGAGCAGAAGG - Intergenic
986841250 5:11700015-11700037 ATGTGTGTGGGGGGCACTGTGGG + Intronic
987019306 5:13852914-13852936 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
987076430 5:14386303-14386325 CTGGGGGACGGGGGTGCTGTTGG + Intronic
987717237 5:21587385-21587407 TTGTGGGTGGGGGTGGTTGTAGG + Intergenic
987945681 5:24605503-24605525 CTATGGATGGGAGGAGGTGTTGG - Intronic
988618267 5:32795554-32795576 CTGGGGGATGGGGCAGCTGTTGG + Intergenic
988891149 5:35618245-35618267 CCCTGGCTGGGGTGAGCTGTAGG - Intronic
989160600 5:38387115-38387137 CTGAGTGTGGAGGGAGGTGTTGG + Intronic
989216270 5:38907747-38907769 CTGTGGTTGGGGGAGGCTGCAGG - Intronic
990134668 5:52631023-52631045 CAGTGGTTGGGGGAAGCTGTAGG + Intergenic
990168152 5:53017920-53017942 CTGTGGCTGGGGGAGGCTGCAGG + Intronic
990224236 5:53631479-53631501 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
990366419 5:55075500-55075522 GTGTGGGTGGGGGGAGGGGGAGG - Intergenic
990393686 5:55354890-55354912 CTGTGGGAGGTGGGTGCGGTTGG - Intronic
990819144 5:59817737-59817759 GTGTGTGTGGGGGGGGGTGTGGG - Intronic
991026621 5:62037242-62037264 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
992083105 5:73253778-73253800 CTGTGTGTGTGGGTAGGTGTAGG - Intergenic
993381808 5:87217462-87217484 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
993402737 5:87473120-87473142 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
993712040 5:91234881-91234903 CTGTGGCTGGGTGGAGCACTAGG + Intergenic
993930861 5:93937271-93937293 GTGTGGGTGGGGGGAGGAGGAGG + Intronic
994015086 5:94955811-94955833 CTGGGGGAAGGGGTAGCTGTGGG + Intronic
994096698 5:95853720-95853742 CAGTGGGTGGGGGCAGCAGTTGG - Intronic
994142808 5:96360927-96360949 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
994793829 5:104267564-104267586 CTCTAGCTGAGGGGAGCTGTGGG + Intergenic
995252225 5:110006592-110006614 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
997004782 5:129804707-129804729 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
997387721 5:133486764-133486786 CGGTGGGTGGGCGGAGCAGAAGG + Intronic
997456241 5:134019705-134019727 ATGGGGGTTGGGGCAGCTGTGGG - Intergenic
997616049 5:135246957-135246979 TTGTTGGTGGGGGGAGGTCTCGG + Intronic
997659144 5:135576741-135576763 CTGGGGGTGGGGGCAGGAGTAGG - Intronic
998101439 5:139438624-139438646 CAGTGGGTGGAGGTAGCTGAGGG - Intronic
998729923 5:145062923-145062945 CTGTGTGTGGGGAGGGCAGTGGG + Intergenic
998752041 5:145333365-145333387 CTGGGGGAAGGGGAAGCTGTGGG - Intergenic
998848649 5:146334416-146334438 AGGTGGGTGGGGGTAGCTGCTGG + Intronic
999030019 5:148280878-148280900 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
999257252 5:150216583-150216605 CTGGAGGTGGAGGGAGCTGGAGG - Intronic
999258169 5:150221434-150221456 AGGTGGGTGGGGGGTGCTGGGGG + Intronic
999466062 5:151806169-151806191 CTGTGGGTGGGTGGAGCTGTGGG + Exonic
999536179 5:152519712-152519734 CTGGTGGTGGAGGCAGCTGTGGG - Intergenic
999608149 5:153339051-153339073 CTGAGGGAAGGGGCAGCTGTGGG - Intergenic
999772822 5:154788306-154788328 CTGGGGGTGTGGGATGCTGTTGG + Intronic
999983978 5:156984988-156985010 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1000672243 5:164077174-164077196 CTCTGGGTGGGGGGAGGGGGTGG + Intergenic
1000702712 5:164473292-164473314 CTGGGGGGGGGGGGCGTTGTTGG - Intergenic
1001122402 5:168991537-168991559 CTGGGGGTGGTGGGGGCAGTGGG - Intronic
1001230008 5:169978389-169978411 GTGTGGGGGGGGGGGGGTGTAGG + Intronic
1001572664 5:172740841-172740863 CTGGGGGTGGGGGCAGTGGTGGG - Intergenic
1001630117 5:173168666-173168688 CTGGGGGTGAGGGGAGGGGTGGG + Intergenic
1001884947 5:175281196-175281218 CTGTGTGTGGGGGAAGTTGGAGG - Intergenic
1002081441 5:176739927-176739949 GTGGGGGAGAGGGGAGCTGTGGG - Intergenic
1002101884 5:176861851-176861873 CTGGGGGTTGTGGGAGCTGAGGG + Intronic
1002170004 5:177369650-177369672 ATGTGGATGGGCAGAGCTGTGGG + Intronic
1002318809 5:178362890-178362912 CTGTGGGGGTGGGTTGCTGTGGG - Intronic
1002318815 5:178362906-178362928 CTGTGGGGGTGGGTTGCTGTGGG - Intronic
1002318821 5:178362922-178362944 CTGTGGGGGTGGGTTGCTGTGGG - Intronic
1002318830 5:178362954-178362976 CTGTGGGGGTGGGTTGCTGTGGG - Intronic
1002318836 5:178362970-178362992 CTGTGGGGGTGGGTTGCTGTGGG - Intronic
1002318842 5:178362986-178363008 CTGTGGGGGTGGGTTGCTGTGGG - Intronic
1002318848 5:178363002-178363024 CTGTGGGGGTGGGTTGCTGTGGG - Intronic
1002318857 5:178363034-178363056 CTGTGGGAGTGGGTTGCTGTGGG - Intronic
1002381441 5:178832327-178832349 CGGTGGGTGGTGGGAGGGGTTGG - Intergenic
1002417968 5:179130597-179130619 CTGGGGCTGTGGGGAGCTGCTGG - Intronic
1002633337 5:180595043-180595065 GTGTGGGTGTGGGGATGTGTGGG + Intergenic
1003016225 6:2469508-2469530 CTGTGGGACGTGGGAGCAGTGGG + Intergenic
1003235699 6:4293789-4293811 CTTGGGGTGGAGGGTGCTGTTGG - Intergenic
1003261017 6:4516157-4516179 CTGCGGGTGGGGGAGGCGGTGGG + Intergenic
1004332462 6:14734412-14734434 CTGTTGGTGTGGGAAGCTGGAGG - Intergenic
1004944426 6:20596257-20596279 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1005583844 6:27257423-27257445 CTGTGGCATGGGGAAGCTGTGGG + Intergenic
1005795812 6:29360309-29360331 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1006181460 6:32155619-32155641 GTGGGGGTGGGGGGTGCTGCTGG + Intronic
1006983999 6:38166038-38166060 GTGCGGGTGGGGGGAGGTGGAGG - Intergenic
1006984010 6:38166069-38166091 GTGCGGGTGGGGGGAGGTGGAGG - Intergenic
1006984021 6:38166100-38166122 GTGCGGGTGGGGGGAGGTGGAGG - Intergenic
1006984114 6:38166401-38166423 GTGCGGGTGGGGGGAGGTGGAGG - Intergenic
1006984125 6:38166432-38166454 GTGCGGGTGGGGGGAGGTGGAGG - Intergenic
1007195553 6:40056875-40056897 CTGGGGGAAGGGGTAGCTGTGGG - Intergenic
1007396097 6:41578687-41578709 CTGGGGGAGGGGAGATCTGTGGG + Intronic
1007396540 6:41581223-41581245 CTGTGAGTGGGGGGCAATGTGGG - Intronic
1007418734 6:41706810-41706832 GTGTGGGCGGGGGGAGATGGGGG - Intronic
1007419573 6:41711684-41711706 CTGGGGCTTGGGGGAGCTGAAGG - Intronic
1007700496 6:43763495-43763517 CTAGGGGTTGGGGGATCTGTTGG - Intergenic
1007762022 6:44138811-44138833 CAGTGAGTGGGGGCAGCAGTAGG + Intronic
1009029993 6:58045358-58045380 CTGTGTGTGGGGTGAGGGGTGGG + Intergenic
1009182552 6:60535894-60535916 ATGTGGGAAGGGGCAGCTGTGGG + Intergenic
1009205521 6:60796588-60796610 CTGTGTGTGGGGTGAGGGGTGGG + Intergenic
1009458805 6:63888183-63888205 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1009709565 6:67300229-67300251 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1010574992 6:77519068-77519090 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1010791664 6:80072132-80072154 GTGTGGGTGGGTGGAGCGGGGGG - Intergenic
1011209219 6:84936592-84936614 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1012127882 6:95453843-95453865 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1012644364 6:101661071-101661093 CTGAGGGAAGGGGCAGCTGTGGG - Intronic
1013207665 6:107958847-107958869 GTGTGGGTTGCGGGAGGTGTGGG + Intergenic
1013304279 6:108833559-108833581 GGGTGGGTGGGGGGTGCTGAGGG + Intergenic
1013481117 6:110553588-110553610 CTCTGGCTGGTGGGAGCTCTAGG + Intergenic
1013925578 6:115468059-115468081 CTGGGGGTGGTGGCAGCTATAGG - Intergenic
1014070423 6:117175421-117175443 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1014223491 6:118822720-118822742 CTGGGGGAAGGGGAAGCTGTGGG - Intronic
1014225255 6:118840016-118840038 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1014239482 6:118999188-118999210 CTGAGGTTGAGGGGAGCTGGCGG + Intronic
1014569094 6:122986736-122986758 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1014753745 6:125280761-125280783 CTGAGGGAAGGGGCAGCTGTGGG + Intronic
1014872582 6:126614640-126614662 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1015108963 6:129569509-129569531 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1015162965 6:130173790-130173812 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1015282792 6:131451955-131451977 CTGTGGGTGGAGGAAGAGGTGGG - Intergenic
1015387020 6:132635671-132635693 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1015853950 6:137603757-137603779 CTGTGGGTGGAGGCAGCAGGAGG + Intergenic
1016511472 6:144848057-144848079 CTAGGGGTGTGGTGAGCTGTGGG + Intronic
1016542213 6:145178491-145178513 CTGAGGGAAGGGGCAGCTGTGGG + Intergenic
1016911167 6:149200649-149200671 CTGTTGGTAGGGGGAGCTGCAGG - Intergenic
1018702681 6:166439651-166439673 ATGTGGGTGAGGGGGGCTGCTGG + Intronic
1018897144 6:168027601-168027623 CTGTGGGAGGTGGGTGCTGGGGG + Intronic
1019127275 6:169849202-169849224 CTGTGGGTTTGGGGTGCTGCCGG - Intergenic
1019299984 7:298018-298040 CTTTCGGTGGGGAGAGCTGGGGG - Intergenic
1019324722 7:432495-432517 CCCTGGGTGGGAGGAGCTCTGGG - Intergenic
1019359294 7:596478-596500 CTGGGGGTGGGGTGAGCACTGGG - Intronic
1019431372 7:1001339-1001361 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431379 7:1001355-1001377 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431389 7:1001389-1001411 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431399 7:1001423-1001445 CTGTGGGTGGGGATTCCTGTGGG + Intronic
1019431409 7:1001457-1001479 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431427 7:1001527-1001549 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431438 7:1001561-1001583 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431449 7:1001595-1001617 CTGCGGGTGGGGGGTCCTGCCGG + Intronic
1019431462 7:1001627-1001649 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431482 7:1001695-1001717 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431492 7:1001729-1001751 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431506 7:1001781-1001803 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431511 7:1001797-1001819 CTGTGGGTAGGGAGTCCTGTGGG + Intronic
1019431515 7:1001813-1001835 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431522 7:1001829-1001851 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431532 7:1001863-1001885 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431542 7:1001897-1001919 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431554 7:1001929-1001951 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431568 7:1001981-1002003 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431578 7:1002015-1002037 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431588 7:1002049-1002071 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431594 7:1002065-1002087 CTGTGGGTGGGGAGTCCTCTGGG + Intronic
1019431603 7:1002099-1002121 CTGTGGGTGGGAAGTCCTGTGGG + Intronic
1019431627 7:1002185-1002207 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431654 7:1002291-1002313 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431663 7:1002323-1002345 CTGTGGGTGTGGAGCCCTGTGGG + Intronic
1019431670 7:1002339-1002361 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431680 7:1002373-1002395 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431696 7:1002423-1002445 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431710 7:1002475-1002497 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431720 7:1002509-1002531 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431749 7:1002615-1002637 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431755 7:1002631-1002653 CTGTGGGTGGGGAGTCCTGCGGG + Intronic
1019431783 7:1002737-1002759 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431803 7:1002804-1002826 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431813 7:1002838-1002860 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431836 7:1002921-1002943 CTGTGGGTAGGGAGTCCTGTGGG + Intronic
1019431854 7:1002991-1003013 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431864 7:1003025-1003047 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431874 7:1003059-1003081 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431888 7:1003111-1003133 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431898 7:1003145-1003167 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431908 7:1003179-1003201 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019431922 7:1003231-1003253 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431948 7:1003337-1003359 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431954 7:1003353-1003375 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431968 7:1003405-1003427 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019431992 7:1003491-1003513 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432012 7:1003558-1003580 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432018 7:1003574-1003596 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432028 7:1003608-1003630 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019432038 7:1003642-1003664 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019432047 7:1003676-1003698 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432057 7:1003710-1003732 CTGCGGGTGGGGAGTCCTGTGGG + Intronic
1019432085 7:1003811-1003833 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432103 7:1003879-1003901 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432117 7:1003931-1003953 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019432131 7:1003983-1004005 CTGTGGGTGGGGAGTCCTGTGGG + Intronic
1019473330 7:1232664-1232686 CTGGGGGCGGGGGGAGCCGGAGG - Intergenic
1019572780 7:1720722-1720744 CGGGGGGTGGGGGGTGCTGGGGG - Intronic
1019577535 7:1744605-1744627 GCGTGGGTGGGGCGCGCTGTGGG + Exonic
1019609893 7:1931059-1931081 CCGTGGGTGGGGTGAGGAGTTGG - Intronic
1019727786 7:2612527-2612549 CCATGGGAGGGGTGAGCTGTGGG + Exonic
1019727802 7:2612576-2612598 CTGTGGGCGGGGCGAGCTGTGGG + Exonic
1019893424 7:3964782-3964804 CTGTGGGTGGGAAGAGCCCTTGG - Intronic
1020607801 7:10360196-10360218 CTGTGGTGGGGGGAAGGTGTGGG + Intergenic
1020694091 7:11392933-11392955 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1021014715 7:15518215-15518237 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1021071707 7:16249273-16249295 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1022237946 7:28480017-28480039 ATGTGGGGGGGGGGAGGTTTTGG - Intronic
1022522882 7:31019341-31019363 CTGTGGCTGTGGTGGGCTGTGGG - Intergenic
1022884489 7:34628652-34628674 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1025943472 7:66089534-66089556 CAGTGGGGGGGTGGGGCTGTGGG + Intronic
1026004795 7:66592159-66592181 CCGGGGTTGGGGGGAGCGGTTGG - Intergenic
1026360964 7:69600102-69600124 TTGTTGGTGGGGGGAGCTGGGGG + Intronic
1026555893 7:71408359-71408381 CTGCTGGTGGGGAGAGGTGTTGG + Intronic
1027969087 7:85054519-85054541 CTGGGGGTGAGGGGATCAGTGGG + Intronic
1028145829 7:87319110-87319132 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1028883650 7:95908616-95908638 CTCTGGGTGGGGCGAGGGGTGGG + Intronic
1028991308 7:97051457-97051479 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1028998317 7:97126411-97126433 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1029137198 7:98381887-98381909 ATGTGGGTGGGGGTAGCTCTGGG - Intronic
1029218208 7:98967720-98967742 CTGTGGCCGGGGGCAGCTGTGGG + Intronic
1029324004 7:99790247-99790269 CTGTGGGTGATAGGAGCAGTTGG - Intergenic
1029393182 7:100288820-100288842 CAGTGGGTATGGGGAGCCGTGGG + Intergenic
1029845203 7:103405773-103405795 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1030140985 7:106304081-106304103 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1030325797 7:108217514-108217536 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1030500767 7:110356377-110356399 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1030958895 7:115889666-115889688 CTGTGGGAAGGGGCAGCTGTGGG + Intergenic
1031371840 7:120977625-120977647 GTGTGTGTGGGGGGAGTTGGTGG + Intergenic
1032074143 7:128828452-128828474 CTGGAGGTGGGGGGAGCTGTGGG - Intergenic
1032151351 7:129432859-129432881 ATGTGGGTGGGGAGAGGAGTGGG + Intergenic
1032215211 7:129952454-129952476 CTGTGTGTGGGGGGCGGTGTGGG - Intronic
1032345058 7:131109609-131109631 GTGGGGGTGGGGGTAGCTGCAGG - Intergenic
1032659693 7:133969939-133969961 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1032883411 7:136114424-136114446 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1033935724 7:146583316-146583338 CAGTGGATGGAGGCAGCTGTTGG + Intronic
1034291217 7:149933159-149933181 CTGGGGCTGGGTGGAGCTATAGG - Intergenic
1034380379 7:150687215-150687237 CTGCTGGTGGTGGTAGCTGTGGG - Intronic
1034814881 7:154163772-154163794 CTGGGGCTGGGTGGAGCTATAGG + Intronic
1035045765 7:155964304-155964326 CTGTGGGCAGGAGGAACTGTGGG + Intronic
1035055399 7:156031894-156031916 GTGTGTGTGGTGGGAGCTGAGGG - Intergenic
1035479821 7:159172492-159172514 CTGTGGGTGGATTGACCTGTAGG + Intergenic
1035828315 8:2668242-2668264 CGGGGGGGGGGGGGAGCTGATGG + Intergenic
1036544027 8:9749281-9749303 CTGTTGGTGGGGGGAGCACGTGG - Intronic
1036560764 8:9898803-9898825 CTGCGGCTGGGGAGCGCTGTGGG + Intergenic
1036576912 8:10036237-10036259 CTGTGGAAGAGGAGAGCTGTAGG - Intergenic
1036674491 8:10818745-10818767 CGTGGGGTGGGGGCAGCTGTTGG + Intronic
1036807547 8:11845840-11845862 CTGAGTGTGGGGGGTGCTGTGGG - Intronic
1037319560 8:17630414-17630436 CTGAGGGTAGGGAGATCTGTTGG + Intronic
1037330151 8:17736338-17736360 CTGTGTGTGGTGGGGGCTGGAGG - Intronic
1037579752 8:20237343-20237365 ATGTGGGTGGGAGGGGCTGAAGG - Intergenic
1037673939 8:21038471-21038493 CTGTGGGCGGACGGAGCTGAGGG - Intergenic
1037699890 8:21264501-21264523 CTCTAGGTGGGGAGATCTGTGGG + Intergenic
1038020945 8:23551391-23551413 CTGTGAGTTGGGGCAGCTGAAGG + Intronic
1038103014 8:24400780-24400802 TTGTGGGTGGGGGGAGGGGGAGG - Intronic
1038480773 8:27900434-27900456 CTGGGGACGAGGGGAGCTGTGGG - Intronic
1038574128 8:28689341-28689363 GTGTGGGAGGCTGGAGCTGTGGG - Intronic
1039105340 8:33983620-33983642 GGGTGGGTGGGGGGTGGTGTGGG + Intergenic
1039801835 8:40964563-40964585 CTGAGGGAGGGGGTGGCTGTGGG + Intergenic
1039864596 8:41490324-41490346 CTGCGGCCGGGGCGAGCTGTGGG - Intergenic
1040022688 8:42754927-42754949 CTGGGGGTGCTGGGAGATGTGGG - Intronic
1040493483 8:47946339-47946361 CTGTGGCTGATGGGAGATGTGGG - Intronic
1040512872 8:48110667-48110689 CTGTGGGTGAGGGGCGGTGCTGG + Intergenic
1040596995 8:48847985-48848007 CTGTGGGTCTGGGGAGGGGTGGG + Intergenic
1040660716 8:49572016-49572038 TGGGGGTTGGGGGGAGCTGTGGG + Intergenic
1040903124 8:52437984-52438006 CAGTGGGTGGAGGGAGTAGTAGG - Intronic
1041657274 8:60366252-60366274 CTGTCAGTGGGGGTAGGTGTGGG - Intergenic
1041832052 8:62165026-62165048 CAGTGGGTGGGGGCAGATATAGG - Intergenic
1042070761 8:64931015-64931037 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1042266385 8:66912779-66912801 CTGTTGGTGGGGAGAGCTAGCGG + Intronic
1043288922 8:78571374-78571396 CTGAGTGTAGGGGGAGATGTAGG - Intronic
1044167316 8:89002630-89002652 CTGTGGGTGGGAAGAACTTTTGG - Intergenic
1044445635 8:92272214-92272236 GTGTGGGTGGGGGGAACAGCTGG - Intergenic
1044807907 8:96027543-96027565 CTGTGGGTGGTGGTTGCTGAAGG - Intergenic
1044826607 8:96204345-96204367 GTGTGGGTGAGGGTAGGTGTTGG - Intergenic
1045185126 8:99830194-99830216 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1045252386 8:100492733-100492755 CTGTGGCTGGGGTGAGGTGGCGG + Intergenic
1046770702 8:118113526-118113548 CTTGGGCTGGGGGGAGCTTTGGG - Intergenic
1046947422 8:119987626-119987648 CTGGGGGAAGGGGCAGCTGTTGG - Intronic
1047748954 8:127865828-127865850 CTGTGGGGAGTGGGAGCTGAGGG + Intergenic
1047816915 8:128474334-128474356 CTGTGGGTGGAAGGAGCAGAGGG - Intergenic
1048210482 8:132450513-132450535 CTGGGGGAGGGGGAAGGTGTTGG - Intronic
1048307598 8:133295147-133295169 CTGTGCATGGGTGGAGGTGTTGG - Intronic
1048467086 8:134674531-134674553 CTGTGGGAAGGGGCAGCTGTGGG + Intronic
1049039682 8:140103070-140103092 CTGTGGGAGTGGGGAGCGGCAGG - Intronic
1049231855 8:141488707-141488729 CTGTGGGGCGCGGGAGCTGGAGG + Intergenic
1049270353 8:141692437-141692459 TTGTGGATGGGGCGAGCAGTGGG - Intergenic
1049298060 8:141854493-141854515 GTGTGGGGGGGGGGGGCTGTGGG - Intergenic
1049378324 8:142300015-142300037 CAGGTGGTGGGGTGAGCTGTCGG - Intronic
1049380853 8:142315140-142315162 GTGTGGGTGGTGGGGGCTGCTGG - Intronic
1049391745 8:142375229-142375251 CTGTGGGTGCCGGGAGCAGCTGG - Intronic
1049687508 8:143944805-143944827 TTGTGGGGGAGGGGAGCAGTGGG + Intronic
1049756196 8:144312255-144312277 CTGTGGGTGGGGCCAGGGGTGGG - Intronic
1049760376 8:144329441-144329463 CTGTGGCTGGGAGGAACTGGGGG + Intergenic
1049790455 8:144469933-144469955 CGGTGGGTGGTGGGGGCCGTGGG + Intronic
1049964659 9:767287-767309 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1050239855 9:3623931-3623953 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1050368982 9:4901679-4901701 CTGGGGGAAGGGGGAGCAGTGGG - Intergenic
1050419370 9:5447304-5447326 TTGTGGGTGGGGGAAATTGTTGG + Intergenic
1050637456 9:7627050-7627072 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1051124860 9:13792183-13792205 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1051308857 9:15747293-15747315 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1051900455 9:22033156-22033178 AGGTGGGTGGGGGGTGCTCTGGG - Intergenic
1052134134 9:24889324-24889346 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1052667956 9:31518974-31518996 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1053425647 9:38008306-38008328 CTGTGGGCGGGGAGAGAAGTGGG - Intronic
1054884872 9:70185493-70185515 CTGGGGGAAGGGGTAGCTGTGGG - Intronic
1055116806 9:72613664-72613686 GTGTGGGTGGTGGGTGCTGTGGG + Intronic
1055390899 9:75821342-75821364 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1055474305 9:76646435-76646457 CTGTAGGTGGTGGTAGCTGTTGG - Intronic
1055571830 9:77624315-77624337 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1055864616 9:80797858-80797880 CCCTTGGTGGGGGGAGCTGGGGG + Intergenic
1056302583 9:85257743-85257765 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1056385096 9:86090341-86090363 CTGGGGGAAGGGGTAGCTGTGGG - Intronic
1057240862 9:93407341-93407363 CTGGGGGTAGGGGGTGCTGGTGG + Intergenic
1057383636 9:94589735-94589757 CTGTGGGTGGGGGTTGGTGTTGG - Intronic
1057486262 9:95486868-95486890 CTGTGGAGTGGGGGAGCTCTAGG - Intronic
1057720651 9:97529159-97529181 TTGTGGTTGGGGGTCGCTGTAGG + Intronic
1058408513 9:104704005-104704027 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1058558995 9:106203822-106203844 CTGGGGGAGGGGGCAGCTGTGGG - Intergenic
1058717072 9:107732054-107732076 CTGAGGGTGGGAGGAAGTGTCGG + Intergenic
1058935630 9:109767240-109767262 CTGGGGTTGGAGGGAGCAGTAGG - Intronic
1059483189 9:114607995-114608017 CTGTGGGTGGGGAGAGGCTTGGG + Intergenic
1059595973 9:115720939-115720961 CTGGGAGTGGGGGTGGCTGTTGG - Intergenic
1060044897 9:120332158-120332180 CTGCGGGTGGGGCGTGCTGCTGG - Intergenic
1060222433 9:121771864-121771886 ATGTGGGTGGGGGGAACTGAAGG - Intronic
1060230147 9:121820023-121820045 CTGCGGGTGGGTGGGGCTATCGG + Intergenic
1060394405 9:123305400-123305422 AGCTGGGTGGGGGGTGCTGTAGG + Intergenic
1060454896 9:123782859-123782881 ATGTGAGCGGGGGGAGCTGGGGG - Intronic
1060925864 9:127454696-127454718 CTGTGGGTGGGGGAGGCAGATGG - Intronic
1060954539 9:127629200-127629222 CTGTGGCTGGCTGGAGCTGTGGG + Intronic
1061084312 9:128390320-128390342 CTAGGGGTGGGGGGAGCAGGAGG - Exonic
1061191756 9:129086313-129086335 CTGTGGGTGGGGCCATCAGTGGG + Intronic
1061192132 9:129088128-129088150 CTGGGGGTGGGGGGAGGTGGGGG + Intronic
1061421275 9:130474057-130474079 CTGTGGGGGGGGGGGGGTGCGGG - Intronic
1061447826 9:130651256-130651278 TTGTGGGTGTGGTGAGGTGTGGG - Intergenic
1061513237 9:131073389-131073411 TTCTGGGTGGGGGCACCTGTGGG - Intronic
1061904889 9:133691503-133691525 GTGGGTGTGGGGGGAGCTGTGGG + Intronic
1061921954 9:133787388-133787410 CTGGGGGTGGGGTGATCAGTGGG + Intronic
1061933924 9:133846991-133847013 CTGTGGGTGGTGCCAGCCGTGGG + Intronic
1062030223 9:134358837-134358859 ATGTGGGTGGTGAGGGCTGTGGG + Intronic
1062249746 9:135588137-135588159 CTGGGGCTGGTGGGAGCTGCAGG + Intergenic
1062383107 9:136297155-136297177 CTGCAGGTGGCGTGAGCTGTGGG + Intronic
1062383111 9:136297171-136297193 CTGTGGGTGGCGTAGGCTGTGGG + Intronic
1062383137 9:136297283-136297305 CTGCGGGTGGTGTGAGCTGCGGG + Intronic
1062383139 9:136297299-136297321 CTGCGGGTGGTGTGAGCTGCAGG + Intronic
1062403569 9:136383020-136383042 CTGTGCGTCGGGGGGACTGTTGG - Intronic
1062405774 9:136395554-136395576 CTCTGGGGGTGGGGAGGTGTGGG + Intronic
1062489112 9:136795939-136795961 CTGGGGGTGGGGGGTGCAGAGGG + Intronic
1062532777 9:137009165-137009187 CTGTGGGGTTGGGGGGCTGTGGG - Intronic
1185464280 X:345881-345903 GTGGGGGTGGGGGCAGCTCTGGG + Intronic
1185555871 X:1020661-1020683 CTGTGGGTGGCAGGGGCTGGGGG - Intergenic
1186201870 X:7163218-7163240 CAGTGGGTGGGAGGTGCTGCTGG - Intergenic
1186202651 X:7169886-7169908 TTGTTGGTGGGGGGGGCTGGGGG + Intergenic
1186599750 X:11024388-11024410 CTGGGGGAGGGGGCGGCTGTGGG - Intergenic
1186771412 X:12821444-12821466 CTGGGGGTGGGGGGGGCAGTGGG + Intronic
1186810153 X:13180601-13180623 CTGGGAGTGGGGGGAGTTGTTGG - Intergenic
1187380033 X:18793683-18793705 CGGGGGGTGGGGGGAGCGGAGGG - Intronic
1187748357 X:22433492-22433514 CTGTTGGTGGGGGGCACAGTGGG + Intergenic
1187839891 X:23476487-23476509 CTGTGGGAAGGGGCAGCTGTGGG - Intergenic
1189279617 X:39812023-39812045 GTGTGGGTAGGGGGAGGTGGGGG - Intergenic
1189317111 X:40064106-40064128 CTTTGGGGGAGGGGAGGTGTGGG + Intronic
1189421283 X:40860502-40860524 CTTTTGGTGGGGGGAACTGATGG - Intergenic
1189575050 X:42342966-42342988 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1189590692 X:42507576-42507598 CTGGGGGAAGGGGCAGCTGTTGG + Intergenic
1190024614 X:46912360-46912382 CGGTGGGTGGGAGGAGAGGTTGG + Intronic
1190441220 X:50476223-50476245 GTGTGTGTGGGGGGATCTGAGGG + Intergenic
1190545943 X:51527266-51527288 CTGGGGGTAGGGAGAGCTATAGG + Intergenic
1190687838 X:52890048-52890070 CTGTGGTCAGGGGGAGGTGTGGG + Intergenic
1190698144 X:52965744-52965766 CTGTGGTCAGGGGGAGGTGTGGG - Intronic
1190748386 X:53340512-53340534 CTGTTGGTGGGGGAAGCTGGAGG - Intergenic
1190946089 X:55095508-55095530 CTGTGGGAAGGGGCAGCTGTGGG - Intronic
1191135312 X:57058186-57058208 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1191174110 X:57481850-57481872 CTGGGGGAAGGGGTAGCTGTGGG - Intronic
1191175100 X:57491131-57491153 CTGGGGGAAGGGGTAGCTGTGGG + Intergenic
1191194612 X:57707782-57707804 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1191208149 X:57855531-57855553 CTGAGGGAAGGGGCAGCTGTGGG + Intergenic
1191785051 X:64908129-64908151 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1191941897 X:66489753-66489775 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1192145689 X:68680733-68680755 GTGGGGGTGGGGGCCGCTGTAGG + Intronic
1192227997 X:69242592-69242614 CTGGGGGTAGGGGGAGCTGTAGG - Intergenic
1192228509 X:69246454-69246476 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1192234119 X:69285410-69285432 CTGGGAGTGGAGGCAGCTGTGGG - Intergenic
1192234961 X:69289817-69289839 GTGGAGGTGGGGGCAGCTGTGGG + Intergenic
1192659661 X:73029250-73029272 CTGTGGGTGGGGGAAGTTAATGG - Intergenic
1192783936 X:74319919-74319941 CTCTGGGTGGGGTCAGTTGTTGG + Intergenic
1192842592 X:74872438-74872460 GTGTGGGTGGGGGGTGGTGGGGG + Intronic
1192903406 X:75523472-75523494 CTGTGGGGGGGGGTAGCAGGGGG - Intronic
1192937970 X:75881243-75881265 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1193068638 X:77283373-77283395 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1193075722 X:77353506-77353528 CTGTTGGTAGGGGCAGCTGGGGG + Intergenic
1193113723 X:77755944-77755966 CTGTGGGAAGGTGCAGCTGTGGG - Intronic
1193219466 X:78906118-78906140 GTGGGGATGGGGGGAGGTGTAGG - Intergenic
1193995275 X:88359037-88359059 CTGTGGGTGGGGGCAGATGCTGG + Intergenic
1194229128 X:91300157-91300179 CTGAGGGAAGGGGCAGCTGTGGG - Intergenic
1194357369 X:92902048-92902070 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1194624830 X:96215074-96215096 CTGGGGGAGGGGGCAGCTGTGGG + Intergenic
1194643345 X:96429157-96429179 CTGGGGGAATGGGGAGCTGTGGG - Intergenic
1194708169 X:97200700-97200722 CTGTGGGGAGGGGCAGCTGCAGG + Intronic
1194837418 X:98698706-98698728 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1195108679 X:101624041-101624063 CTGTGGTTGGGGGGAAGTGGGGG + Intronic
1195127383 X:101822140-101822162 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1195140153 X:101950725-101950747 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1195434643 X:104828723-104828745 CTGGGGGAGGGGGCGGCTGTGGG - Intronic
1195710053 X:107766461-107766483 GTTGGGGTGGGGGGAGTTGTTGG - Intronic
1195774768 X:108391290-108391312 CTGGGGGAAGGGGCAGCTGTGGG - Intronic
1195969834 X:110461215-110461237 CCGTGGGAGAGGGGTGCTGTTGG - Intergenic
1196273115 X:113735600-113735622 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1196571328 X:117268893-117268915 CTGGGGGAAGGGGCAGCTGTGGG + Intergenic
1196602895 X:117622681-117622703 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1196743792 X:119049776-119049798 CTGGGGGTAGGGGGAGATGGTGG + Intergenic
1196746131 X:119073127-119073149 CTGTGGCTGAGGGGAGGTGAGGG - Intergenic
1196946542 X:120832656-120832678 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1197554984 X:127942084-127942106 CTGTGGGTGGGGAGTGGTGGGGG - Intergenic
1197830716 X:130639323-130639345 GTGTGGGTGGGGGGTGATGGTGG + Intronic
1197880703 X:131164005-131164027 CTGGGGGAAGGGGCAGCTGTGGG - Intergenic
1198062644 X:133062288-133062310 CTGGGGGAAGGGGCAGCTGTGGG + Intronic
1198579643 X:138049295-138049317 CTGCAGTTGGGGGAAGCTGTGGG - Intergenic
1199424164 X:147681790-147681812 CTGAGGGTAGGGGGCACTGTGGG + Intergenic
1199801268 X:151253260-151253282 CTGAGGGGAGGGGTAGCTGTGGG + Intergenic
1199983948 X:152937061-152937083 CTGTGGGTGTGTGGAGCATTTGG + Intronic
1200014426 X:153147653-153147675 GTGTTGGTCGGGAGAGCTGTAGG - Intergenic
1200025176 X:153252301-153252323 GTGTTGGTCGGGAGAGCTGTAGG + Intergenic
1200344553 X:155435569-155435591 CTGTGGGCAGGGGGAGGGGTGGG + Intergenic
1200407661 Y:2829823-2829845 CTGGGGGAAGGGGTAGCTGTGGG + Intergenic
1201301427 Y:12508330-12508352 TTGAGGGGGTGGGGAGCTGTGGG - Intergenic
1201755485 Y:17482004-17482026 CTCTGGGTGGGGGGTGTTGACGG + Intergenic
1201846067 Y:18423981-18424003 CTCTGGGTGGGGGGTGTTGACGG - Intergenic
1202197241 Y:22308016-22308038 TTGCGAGTGGGGCGAGCTGTGGG - Intergenic
1202378334 Y:24257364-24257386 CTGTGGGTCAGGGGAGGTGGAGG - Intergenic
1202492448 Y:25412757-25412779 CTGTGGGTCAGGGGAGGTGGAGG + Intergenic