ID: 902817194

View in Genome Browser
Species Human (GRCh38)
Location 1:18923035-18923057
Sequence CACACGGCTCAGAGCGGGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 159}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902817186_902817194 1 Left 902817186 1:18923011-18923033 CCGAGCTGAATCATCTCTCCTGG 0: 1
1: 0
2: 2
3: 15
4: 190
Right 902817194 1:18923035-18923057 CACACGGCTCAGAGCGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 159
902817185_902817194 2 Left 902817185 1:18923010-18923032 CCCGAGCTGAATCATCTCTCCTG 0: 1
1: 0
2: 4
3: 33
4: 768
Right 902817194 1:18923035-18923057 CACACGGCTCAGAGCGGGGAAGG 0: 1
1: 0
2: 0
3: 13
4: 159

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902817194 Original CRISPR CACACGGCTCAGAGCGGGGA AGG Intronic
900113460 1:1019389-1019411 CGCCCGGCCCAGAGCTGGGAAGG + Intergenic
900186725 1:1336392-1336414 CACACGGCACCGAGTGGGGTGGG - Exonic
900208089 1:1440015-1440037 CGCCCGGCTCTGGGCGGGGATGG - Exonic
900988864 1:6088792-6088814 CACAGGGCTCAGAGGGGAGGGGG - Intronic
901034300 1:6327114-6327136 TACATGGCTCAGGGCGGGGCTGG + Intronic
901810005 1:11762139-11762161 CCCACGGCTCAGGGCTGGGCGGG + Exonic
902520806 1:17014816-17014838 CACACTGCTCAGGTCAGGGAGGG - Intergenic
902613346 1:17609940-17609962 CACACTGCCCAGAGCAGGGCTGG - Intronic
902817194 1:18923035-18923057 CACACGGCTCAGAGCGGGGAAGG + Intronic
903259958 1:22126280-22126302 CACACGGCTCAGGGCTGGGGGGG - Intronic
907277628 1:53326127-53326149 CACATGACTCAGAGCCGGGCAGG + Intronic
915357143 1:155262132-155262154 AACATGGCTCAGAGCAGAGACGG - Exonic
921346178 1:214187604-214187626 CACACGCCTGAGAGCGGAGCCGG - Intergenic
922345281 1:224691237-224691259 CACAAGGCCCTGAGCTGGGAAGG - Intronic
923559600 1:235028488-235028510 AACCAGGCTCAGAGAGGGGAAGG + Intergenic
1067091024 10:43265990-43266012 CTCACTGCTCTGAGCAGGGAGGG + Intronic
1070331047 10:75417577-75417599 CACCTGGCTCAGAGTGAGGAGGG - Intergenic
1070767312 10:79064187-79064209 CACAGGGCTCAGAGCTGGGCAGG + Intergenic
1071564083 10:86662626-86662648 CACTAGGGCCAGAGCGGGGATGG + Intronic
1075086922 10:119419837-119419859 CCCACGGCTCAGAGAAGGGAGGG - Intronic
1075123436 10:119681040-119681062 CAGAGGGCTGAGAGCGGGGCTGG + Intergenic
1075259992 10:120955045-120955067 GACAGGGCTCATAGAGGGGAGGG + Intergenic
1075654140 10:124150368-124150390 CACACAGCTCAGAGTAGGGCTGG + Intergenic
1076120687 10:127934721-127934743 CCCCAGGCACAGAGCGGGGAAGG - Intronic
1082807760 11:57461137-57461159 GACCCGGCCCGGAGCGGGGAGGG + Intronic
1083660224 11:64248661-64248683 CACAGGGCTCAGTTCAGGGAAGG + Intergenic
1085248936 11:75128807-75128829 CACAAGGATCAGAGCAAGGATGG - Intronic
1089398655 11:118152193-118152215 CAAACGGCTCTGGGCCGGGATGG + Intronic
1089994550 11:122893296-122893318 CACACTCCTCAGAGCAGGCATGG + Intronic
1091122019 11:133064746-133064768 CACACGGCCCGGCGCGGGGCGGG + Intronic
1091124450 11:133082630-133082652 CACTCGGCGCAGAACGGGGTGGG - Intronic
1091392398 12:133573-133595 CACAGGGCTCAGGGCAGGGTTGG + Intronic
1092126544 12:6078770-6078792 GTCACGGCTCTGAGAGGGGAGGG - Intronic
1096533317 12:52255425-52255447 CACAAGGCTCAGATCTGGGGAGG + Intronic
1099017204 12:77358426-77358448 CACACTGCTCAGAGCAAGGCAGG - Intergenic
1101995645 12:109523346-109523368 CAGAGGGCTCTGAGCAGGGAAGG - Intronic
1102636602 12:114329975-114329997 ACCAAGGCTCAGAGAGGGGAAGG - Intergenic
1102641913 12:114374282-114374304 GACACGGCTTAGGGTGGGGATGG + Intronic
1103402521 12:120652953-120652975 CACCAGGCTCAGAGCTGGGCAGG + Intronic
1103827038 12:123747288-123747310 CACACAGCTCAGAGACTGGAAGG - Intronic
1103871728 12:124097140-124097162 CAAAAGGCTCTGAGCTGGGAAGG - Intronic
1104732797 12:131117666-131117688 CACATGCCTCAGAGCCAGGAAGG + Intronic
1105296066 13:19088916-19088938 CACACTGCTCTGAGGGGGCAAGG - Intergenic
1113040838 13:106102254-106102276 CACAGGTCTCAGAGGAGGGAAGG + Intergenic
1117912671 14:60649598-60649620 CGCACCGCCCAGAGCGGGGAGGG + Intronic
1118597427 14:67446661-67446683 GACATGGCGCAGAGCAGGGAGGG + Intergenic
1119892279 14:78191864-78191886 CACACAGCTCAAAGAGGGGAAGG - Intergenic
1121304754 14:92899032-92899054 CGCACGGGGCAGAGGGGGGAGGG + Intergenic
1122237650 14:100341283-100341305 CACAGGGTGCAGAGTGGGGAGGG - Intronic
1122425190 14:101601679-101601701 CAGAAGGCTCAGAGAGGTGAGGG - Intergenic
1122659728 14:103287332-103287354 CACACAGCACAGAGTGAGGATGG - Intergenic
1124253295 15:28121716-28121738 CACAGGGCACAGAACAGGGAGGG + Intronic
1124722451 15:32121785-32121807 CACAGGGCCCTTAGCGGGGAGGG + Intronic
1128261342 15:66235133-66235155 CACATGGCGGAGGGCGGGGAAGG + Intronic
1129108432 15:73323973-73323995 CACTCAGGGCAGAGCGGGGAAGG + Intronic
1129248965 15:74297796-74297818 CACAGGGCTGAGACCAGGGAGGG - Intronic
1132804553 16:1769523-1769545 GACACGGGTCAGAACGGGGCTGG - Exonic
1132889302 16:2196251-2196273 CACCCGGCGCCGGGCGGGGAGGG - Intronic
1136019011 16:27428232-27428254 TACAAGGCTCAGAGAGGGCAAGG + Intronic
1136936288 16:34468769-34468791 CACACAGCTCAAAGCGGAGCAGG - Intergenic
1136940327 16:34518609-34518631 CACACAGCTCAAAGCGGAGCAGG - Intergenic
1136948371 16:34684329-34684351 CACACAGCTCAAAGAGGAGAAGG + Intergenic
1136959493 16:34829961-34829983 CACACAGCTCAAAGCGGAGCAGG + Intergenic
1136963532 16:34879801-34879823 CACACAGCTCAAAGCGGAGCAGG + Intergenic
1136967680 16:34934330-34934352 CACACAGCTCAAAGCGGAGCAGG + Intergenic
1138474131 16:57260738-57260760 CACAGGGCTGAGAGCGGACATGG - Intronic
1138601113 16:58055124-58055146 CCCAAGGCTCAGAGAGGTGAAGG + Intergenic
1140781557 16:78301612-78301634 CCCACGGCTCTGAGCTGGAAAGG + Intronic
1141779978 16:86152886-86152908 CACAGGACACAGAACGGGGAAGG + Intergenic
1142112896 16:88341593-88341615 CGCACGGCTCACAGCTGGGACGG + Intergenic
1142201984 16:88765452-88765474 CTCAAGGCACAGAGAGGGGAGGG - Intronic
1142223380 16:88865949-88865971 CACACGGCCCTGAGCCGGGCAGG + Intronic
1142374024 16:89697664-89697686 CTCACGGCGCAGAGAGAGGAAGG + Exonic
1142763462 17:2054017-2054039 CACACGGCGTGGAGCGGGGGGGG - Intergenic
1143032267 17:3974323-3974345 CACCCTGCACAGAGCGGGGCAGG + Intergenic
1144682441 17:17204846-17204868 CACACCACCCAGAGCAGGGAGGG + Intronic
1147044444 17:37742913-37742935 AACGCGGCTTAGAGGGGGGAAGG - Intronic
1147210604 17:38870618-38870640 CGCTCGGCGCAGAGCGGAGAGGG - Intronic
1148779265 17:50112461-50112483 CCCAGGGCTCAGAGCTGGGCTGG - Intronic
1150101450 17:62427250-62427272 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1150250208 17:63700606-63700628 CCCACAGCTCTGGGCGGGGATGG - Intronic
1151269616 17:72984059-72984081 CTCATGGCTCAGAGTGGGGCTGG + Intronic
1151802314 17:76385489-76385511 GCCACGGCTCCGGGCGGGGAAGG + Exonic
1152391415 17:80006061-80006083 CCCACCGCTCAGAGTGGCGATGG + Intronic
1152551328 17:81031894-81031916 CACAGGGCGCCGAGCGGGGCCGG - Intergenic
1152697151 17:81803192-81803214 CACTGGGCACAGAGCAGGGATGG + Intergenic
1152730421 17:81967179-81967201 CAACCGGCTCAGAGTGGGGGAGG + Intergenic
1152901263 17:82942361-82942383 CACAGGGCCCAGAGGGGTGAGGG + Intronic
1203183228 17_KI270729v1_random:85809-85831 CACACAGCTCAGAGAGGAGCAGG + Intergenic
1160855134 19:1213853-1213875 CCCACGGCTCAGAGCAGGACTGG - Intronic
1164207668 19:23071389-23071411 CGCCCAGCTCACAGCGGGGACGG + Intergenic
1166066044 19:40359535-40359557 CACAAGGATCTGAGCAGGGAGGG + Intronic
1167088216 19:47324814-47324836 CACACCTCTCAGAGCCAGGAAGG + Intergenic
1167497423 19:49827800-49827822 CAGACAGCCCAGAGAGGGGAGGG + Intronic
1168101825 19:54145429-54145451 CACAGGGCTCAGAGGGTGGGTGG + Intronic
1202681701 1_KI270712v1_random:11121-11143 CACACAGCTCAAAGAGGAGAAGG + Intergenic
925107006 2:1300205-1300227 CACACCCTTCAGAGCGGTGATGG - Intronic
926159129 2:10475503-10475525 CCCCCGGCCCAGGGCGGGGAGGG + Intergenic
926329043 2:11809917-11809939 AACAAAGCTCAGAGTGGGGAAGG - Intronic
928197483 2:29225969-29225991 CACTGGGCTCACAGTGGGGAGGG + Intronic
935115319 2:100130519-100130541 CACACGGCTGAGCCCGTGGATGG - Intronic
938220619 2:129563608-129563630 CACAAGCCACAGAGTGGGGAAGG - Intergenic
938427443 2:131203129-131203151 CACCCGGCCCAGAGGGGGCAGGG - Intronic
938468387 2:131537177-131537199 CACCCGGCCCAGAGGGGGCAGGG - Intergenic
939243394 2:139592094-139592116 CAGATGGATCAGAGCAGGGATGG - Intergenic
941003470 2:160224135-160224157 CACAGGGCTCAGCTCAGGGATGG + Intronic
944221715 2:197310376-197310398 CCGACGGCCCAGGGCGGGGACGG + Intronic
948283373 2:236765792-236765814 CACATGGCTCAGTCCAGGGAGGG - Intergenic
948631280 2:239304228-239304250 CACAAAGCCCAGAGCTGGGAAGG + Intronic
948764929 2:240214673-240214695 CACACAGCTCAAAGCGGGAGAGG + Intergenic
948836742 2:240629555-240629577 CACACAGCTCTTAGCAGGGAGGG - Intronic
1173595616 20:44257123-44257145 CGCCAGGGTCAGAGCGGGGAAGG - Intronic
1173794401 20:45848951-45848973 CACACTGCTCAGAGAAGTGAAGG - Intronic
1174449140 20:50609126-50609148 CACCAGGCTCAGAGAGGGGTGGG + Intronic
1175367645 20:58466954-58466976 CACGCGGACCAGAGTGGGGAGGG + Intronic
1175891951 20:62319640-62319662 CTCAGGGCTCAGAGCCAGGAGGG - Intronic
1182282544 22:29225731-29225753 GACACGGCTCAGAGCAGGAAGGG - Intronic
1183304390 22:37074531-37074553 CACTCAGCTCAGAGCAGGAAAGG + Intronic
1183319262 22:37155208-37155230 GACACGGCTCTGAGCAGGGCAGG - Intronic
1184373419 22:44097107-44097129 CACACAGCTCAGAGATGGCATGG + Intronic
1184814219 22:46858463-46858485 CACATGGATCAGAGCTGGGGGGG - Intronic
950262045 3:11549833-11549855 CACACTGCTCCTAGTGGGGATGG - Intronic
961665461 3:128491211-128491233 CAAAGGGCTCAGAGGGGGGGGGG - Intronic
967135492 3:186509535-186509557 CACACAGCTCTGAGTGGGGAGGG + Intergenic
968753533 4:2402606-2402628 CACACAGCAGAGAGCGGGCAGGG + Intronic
971362661 4:25951854-25951876 CACAGGGCTCACAGAGGGGCTGG + Intergenic
975801409 4:78062175-78062197 CACATGGCTCAGAGTAGGGGAGG + Intronic
981012399 4:139938987-139939009 CACAGTGCGCAGAGCGGGGAAGG - Intronic
985301640 4:188496384-188496406 CCCAAAGCTCAGAGCTGGGAGGG - Intergenic
997975913 5:138441122-138441144 CACATGGCACAGAGAGGGGAGGG + Intronic
999219146 5:149960676-149960698 AACTCGGCCCAGACCGGGGAGGG - Intergenic
1002053944 5:176587751-176587773 CACTCGGCTCTAAGTGGGGAAGG - Intronic
1003137450 6:3444677-3444699 CACAGGGCTCAGAGAGAGGCCGG - Intronic
1003371716 6:5534016-5534038 TACACTGTTCAGAGCTGGGAGGG + Intronic
1005899660 6:30206426-30206448 CACAGGGCTCAAAGAGGGGCAGG + Intronic
1005952741 6:30643532-30643554 GACTCTCCTCAGAGCGGGGAAGG - Intronic
1006455519 6:34129786-34129808 CACAAGGCTCAGAGCTGGAAGGG - Intronic
1010209454 6:73351638-73351660 CACAGGTCTCAGGGCTGGGACGG + Intergenic
1011983463 6:93416654-93416676 CACTCTGCTCCGAGCGGGAAGGG - Intronic
1016888253 6:148979724-148979746 CACAGAGCTAAGAGCGGGCATGG - Intronic
1019132705 6:169889040-169889062 TACAAGGCTCAGAGCAGTGAAGG - Intergenic
1019603212 7:1895633-1895655 AACACGGCCCAGAGCAGGCATGG + Intronic
1021717602 7:23473935-23473957 CTCACGGCTCACAGTGGGGAGGG + Intergenic
1026846163 7:73700233-73700255 CACACGACACGGGGCGGGGACGG + Exonic
1026858728 7:73770987-73771009 GACAGGGCTCGGAGAGGGGAGGG - Intergenic
1027190251 7:75992339-75992361 AACAGGGCCCAGAGAGGGGAGGG + Intronic
1027260976 7:76464348-76464370 CAGAGGGCTCTGAGCGAGGAGGG + Intronic
1027312353 7:76962460-76962482 CAGAGGGCTCTGAGCGAGGAGGG + Intergenic
1029728911 7:102426533-102426555 TACAGGGCTCAGAGAGGGGCCGG - Exonic
1029816198 7:103097902-103097924 CACAGGGCACAGAGCTGGGTGGG - Intronic
1032030600 7:128480109-128480131 CTCACTGCTCAGAGAGGGTAAGG - Intronic
1035040147 7:155921169-155921191 CCCTGGGCTCAGAGCAGGGAGGG + Intergenic
1036805379 8:11828423-11828445 CACAGGGCTCAGAGAAGGGAAGG + Intronic
1049258017 8:141624239-141624261 GACAGGGCTCACAGCTGGGAAGG + Intergenic
1049278316 8:141731078-141731100 CACAGGGCTGAGAGTGGGGGAGG - Intergenic
1049342558 8:142120980-142121002 CACAGGGCTGAGTGAGGGGATGG + Intergenic
1049546683 8:143235113-143235135 ACCACGGCTCAGAGAGGGCAGGG - Intergenic
1049802995 8:144526881-144526903 CACCAGGGTCAGAGCCGGGATGG + Exonic
1050013539 9:1209413-1209435 CACAGGGCCCAGACCAGGGAGGG + Intergenic
1053297268 9:36923796-36923818 CACACTCCTCAGTGCAGGGATGG + Intronic
1057906715 9:98989132-98989154 CACACCGGGCAGAGCGGGCAGGG - Intronic
1058053428 9:100427638-100427660 CCCACGGCTGGGAGCGGGGTGGG + Intronic
1059313061 9:113401458-113401480 CGCAGGGCCCGGAGCGGGGACGG - Intergenic
1059811127 9:117856796-117856818 CGCAAGGCTCAGAGTGGTGATGG - Intergenic
1060431043 9:123551783-123551805 TGCCCGGCTCAGGGCGGGGAGGG - Intronic
1060816097 9:126636055-126636077 CAAAAGGCTCATAGAGGGGAGGG - Intronic
1061703499 9:132434221-132434243 AAAACACCTCAGAGCGGGGATGG - Intronic
1061873998 9:133534969-133534991 CCCACTGCTCAGAGTGGGGCTGG + Intronic
1062521471 9:136959684-136959706 CGCACGGCTCACGGTGGGGAGGG + Intergenic
1185675431 X:1845421-1845443 AAGATGGCACAGAGCGGGGAGGG + Intergenic
1186407101 X:9313728-9313750 CACACTGCTCAGAGAGGTGGTGG + Intergenic
1190649934 X:52559114-52559136 CACACTGCTTAGAGAGGGCAAGG - Intergenic
1199596954 X:149513501-149513523 CACAAGGCTGAGAGCAGGGGTGG + Intronic