ID: 902817222

View in Genome Browser
Species Human (GRCh38)
Location 1:18923219-18923241
Sequence CCCCTGGGTGCCTGCGTCCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 251
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 231}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902817222_902817237 18 Left 902817222 1:18923219-18923241 CCTTGGACGCAGGCACCCAGGGG 0: 1
1: 0
2: 1
3: 18
4: 231
Right 902817237 1:18923260-18923282 CATTCCCCAGAGGGGCCCTTGGG 0: 1
1: 0
2: 0
3: 15
4: 161
902817222_902817231 9 Left 902817222 1:18923219-18923241 CCTTGGACGCAGGCACCCAGGGG 0: 1
1: 0
2: 1
3: 18
4: 231
Right 902817231 1:18923251-18923273 GACACTCCCCATTCCCCAGAGGG 0: 1
1: 0
2: 7
3: 553
4: 2920
902817222_902817241 25 Left 902817222 1:18923219-18923241 CCTTGGACGCAGGCACCCAGGGG 0: 1
1: 0
2: 1
3: 18
4: 231
Right 902817241 1:18923267-18923289 CAGAGGGGCCCTTGGGAATGAGG 0: 1
1: 0
2: 1
3: 30
4: 308
902817222_902817236 17 Left 902817222 1:18923219-18923241 CCTTGGACGCAGGCACCCAGGGG 0: 1
1: 0
2: 1
3: 18
4: 231
Right 902817236 1:18923259-18923281 CCATTCCCCAGAGGGGCCCTTGG 0: 1
1: 0
2: 2
3: 27
4: 297
902817222_902817232 10 Left 902817222 1:18923219-18923241 CCTTGGACGCAGGCACCCAGGGG 0: 1
1: 0
2: 1
3: 18
4: 231
Right 902817232 1:18923252-18923274 ACACTCCCCATTCCCCAGAGGGG 0: 1
1: 2
2: 3
3: 34
4: 853
902817222_902817230 8 Left 902817222 1:18923219-18923241 CCTTGGACGCAGGCACCCAGGGG 0: 1
1: 0
2: 1
3: 18
4: 231
Right 902817230 1:18923250-18923272 CGACACTCCCCATTCCCCAGAGG 0: 1
1: 0
2: 2
3: 15
4: 126

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902817222 Original CRISPR CCCCTGGGTGCCTGCGTCCA AGG (reversed) Intronic
900109598 1:999953-999975 CCCCGGCGTGTCTGCGGCCATGG + Exonic
900367571 1:2317526-2317548 CCCCTGGGAACCTGAGGCCAGGG - Intergenic
900435728 1:2629664-2629686 ACCCTGGGTGACTGGGTCCCGGG + Intronic
901857978 1:12056479-12056501 CCCATGGGTGCGTCCGTGCAGGG - Intergenic
902618955 1:17639461-17639483 CCCCTGGGGGACTGAGCCCATGG - Intronic
902625568 1:17674244-17674266 CCCCTGGGACCCTTGGTCCATGG + Intronic
902817222 1:18923219-18923241 CCCCTGGGTGCCTGCGTCCAAGG - Intronic
905653370 1:39671316-39671338 GCGCTGGGAGCCTGCGGCCAGGG + Intronic
906556973 1:46721771-46721793 CCCCTGGGTTCCTCAGTCCCTGG - Intergenic
907102676 1:51851028-51851050 CCCAAGGGTGGCTGCGGCCAGGG - Intronic
907242566 1:53088874-53088896 CACCTCGGTGCCTGTGTCCCGGG + Exonic
909984563 1:82144670-82144692 CCCCTGGGTGGCTGCCTGGATGG - Intergenic
911162140 1:94691854-94691876 CCCCCGTGTGGCTGGGTCCAGGG + Intergenic
915645773 1:157270922-157270944 CTGCTGGGTGCCTGGGTCCTGGG - Intergenic
916678436 1:167083469-167083491 CTGCTGGGTGCCTGTGTCCTGGG + Intronic
916854762 1:168738170-168738192 CCCCTGGCTCCCTGCCACCAAGG + Intergenic
918814863 1:189169471-189169493 CCCCTTGGTCCCTGCCTCCTAGG - Intergenic
919989243 1:202697628-202697650 CCCCTGGGACCCTGAGTCCTGGG - Intronic
922561867 1:226575434-226575456 ACCCTGGGTGCCTGCCGGCAGGG - Intronic
922919539 1:229290362-229290384 CACCTGGCTGCCAGCGACCAGGG - Intronic
1063234482 10:4098563-4098585 CCCATGGGTGCCTTCGCCAATGG + Intergenic
1063418116 10:5889903-5889925 CCCCTGGGGGCCGGCGTTCCTGG + Intronic
1064107608 10:12513248-12513270 CCCAGGGCTGCCCGCGTCCAGGG - Intronic
1067738262 10:48876071-48876093 CCCCTGGGTGTCTGTGACCCTGG + Intronic
1069010522 10:63366792-63366814 CTCCTGGGTGCCTGGGTCACTGG + Intronic
1070085927 10:73237038-73237060 TCCCTGTGTGTCTGTGTCCAGGG + Intronic
1073456325 10:103638818-103638840 CGCCTGGGTGACTGGGGCCAGGG + Intronic
1074298864 10:112215285-112215307 CCTCTGGGTGCCTGTTTGCACGG + Intronic
1074570773 10:114622114-114622136 GCTATGGGTGCCTGGGTCCATGG - Intronic
1075227236 10:120640674-120640696 TCCCTGGGTCCCTGAGTTCAAGG - Intergenic
1075438185 10:122460485-122460507 ACCCTGGGTGCCTCTGCCCAGGG + Intergenic
1076109209 10:127848436-127848458 GTGCTGGGTGCCTGGGTCCACGG + Intergenic
1076549184 10:131267118-131267140 CCCCTGGGTGCAAGCGGCCTGGG - Intronic
1076569257 10:131421547-131421569 CCCGTGGGTGCCTGGGTCATGGG + Intergenic
1076569272 10:131421609-131421631 CCCGTGGGTGCCTGGGTCACGGG + Intergenic
1076829737 10:132988501-132988523 CAGCTGGGTGCCTGAGGCCAAGG + Intergenic
1077894668 11:6444782-6444804 ACCCTGGGTGCCTGACTCCTAGG + Intergenic
1079099426 11:17531582-17531604 TCCCTGGGTGCCTGAGGTCATGG - Intronic
1079579229 11:22041690-22041712 CCTCTGGGTGCATGCATCCCTGG - Intergenic
1082641549 11:55667193-55667215 CCCCTCGGTGTCTGGTTCCAGGG - Intergenic
1084969800 11:72764861-72764883 CCCTTGGGTTCCTGTTTCCAGGG - Intronic
1087105194 11:94401266-94401288 CCCCTGGGAGCCTGCGGGCCGGG + Exonic
1088331911 11:108663371-108663393 CCCCTGGTTGCCTGAGTCCCTGG + Intergenic
1090204640 11:124877589-124877611 CCCCTGGGTTCCTGGGCCGAGGG - Exonic
1091224622 11:133950097-133950119 CCAGTGGGTGGCTGAGTCCAGGG + Intronic
1091743481 12:2976474-2976496 CCTCTGGGTACCTGTTTCCAGGG + Intronic
1091948223 12:4568273-4568295 GCCCTGGGTGAGTGCATCCATGG + Intronic
1092950728 12:13500607-13500629 CCGGTGGTTGCCTGCATCCAGGG - Intergenic
1097190647 12:57217843-57217865 CACCTGTGTGCATGTGTCCAGGG + Intronic
1098711761 12:73771738-73771760 CTCCTGCGTGGCTGGGTCCAGGG + Intergenic
1098768072 12:74514949-74514971 CCTCTGTGTGGCTGAGTCCAGGG + Intergenic
1101376386 12:104174918-104174940 CCCCAGGGTCCCTGTTTCCATGG - Intergenic
1102663433 12:114549251-114549273 CCCCCGTGTGGCTGGGTCCAGGG + Intergenic
1103896751 12:124278184-124278206 CCCCTGGGGCCCTGAGTCTAGGG - Intronic
1103914678 12:124370125-124370147 GCCCTGGCTGCCTGCCTCCAGGG + Intronic
1104540643 12:129661239-129661261 CTCCAGTATGCCTGCGTCCATGG - Intronic
1104956087 12:132466528-132466550 ACCATGGGTGCCTGTGACCAGGG + Intergenic
1104965778 12:132508268-132508290 CCCGGGGCTGCCTGCCTCCAGGG - Exonic
1105337364 13:19486539-19486561 CAGCTGTGTGCCTGCGTCCTGGG - Intronic
1107167084 13:37295258-37295280 CCACAGGGGGCCTGCGCCCATGG + Intergenic
1108746916 13:53405454-53405476 CCCCCGTGTGACTGAGTCCAGGG - Intergenic
1112201779 13:97283439-97283461 CCCCTGGGTGCCTTGTTCCCTGG + Intronic
1113531286 13:111029400-111029422 CACCTGGGAGCGTGTGTCCAAGG + Intergenic
1113748550 13:112763060-112763082 TGGCTGAGTGCCTGCGTCCAGGG + Intronic
1116919726 14:50560388-50560410 CTGCTAGGTGCCTGCGTCCACGG + Intronic
1119209174 14:72817109-72817131 CCCCGGGGGGACAGCGTCCAGGG + Intronic
1121244479 14:92452021-92452043 CCCCAGGATGCCTGCCTCCCGGG - Intronic
1122632334 14:103112661-103112683 ACCCTGGGTGCCTCAGTCCTGGG + Intergenic
1122875106 14:104660313-104660335 TCCCTGGGTGCCTCCGCCCCAGG + Intergenic
1125678036 15:41512868-41512890 CCCCTCGGTGCCTGAGAGCAAGG + Exonic
1127327964 15:57913736-57913758 CCCCAGGGAGACTGCTTCCAAGG - Intergenic
1129080337 15:73033769-73033791 GCCCTGGGTGCCTCCTTCCCTGG + Intergenic
1129235311 15:74220206-74220228 TCCCTGGGTCCCTGCGTCCTTGG - Intergenic
1129262468 15:74376313-74376335 ACCCTGGGTGCCTGCCACCATGG + Intergenic
1129323422 15:74787155-74787177 CCTCTGGGTCCCTTCATCCAAGG + Intronic
1129845759 15:78767082-78767104 CCCCTGGCAGCCTGCCTCCCAGG - Intronic
1130256102 15:82326778-82326800 CCCCTGGCAGCCTGCCTCCCAGG + Intergenic
1130598851 15:85263208-85263230 CCCCTGGCAGCCTGCCTCCCAGG - Intergenic
1132021868 15:98369698-98369720 CCCCAGTGTGCCTGGCTCCAGGG + Intergenic
1132457973 16:34805-34827 CCCCTGGGGGCCTCCCTCCTGGG - Intergenic
1132631947 16:922190-922212 CCCCTGGGTGGTTGCTGCCAAGG - Intronic
1132666842 16:1084877-1084899 CCCATGGGTGCCTCCCTCCATGG + Intergenic
1132765830 16:1533758-1533780 CCCCTGTGTGGATGCCTCCAGGG - Exonic
1133598169 16:7312921-7312943 CCCCAGGGTGCCTGGGTGCTTGG + Intronic
1134846798 16:17447271-17447293 CCCCTGGGTGCCTGTAGCCTGGG + Intronic
1135597992 16:23757646-23757668 GCCCTGCGTCCATGCGTCCATGG - Exonic
1136344487 16:29665907-29665929 CCTCTGGCTGCCTCTGTCCATGG - Exonic
1138497215 16:57415936-57415958 ACCCTGAGCGCCTGGGTCCAGGG + Exonic
1140211468 16:72973931-72973953 CCCCTGGGTTCCCGCTTCCTGGG + Intronic
1141099666 16:81188035-81188057 CCCCTTGCTGCCTGCATTCAGGG + Intergenic
1141522414 16:84589844-84589866 CAGCTGGGTGCCTGCCTCCGTGG - Intronic
1141809540 16:86365767-86365789 CAGCTGGGTGCCAGGGTCCACGG + Intergenic
1142234661 16:88915987-88916009 TCCATGGGTGCCTGTGTGCATGG + Intronic
1142264728 16:89058464-89058486 CCCCTGGGGGCCTGGGTCCCAGG - Intergenic
1142469636 17:156121-156143 TCCCTGGGTGCCTGCCACCTGGG + Intronic
1143519252 17:7436292-7436314 CCCCTGGGTCCCTACGCCCGGGG + Exonic
1143906887 17:10216296-10216318 CACCTGGCTGCCTGCCTCCAGGG + Intergenic
1145815773 17:27793874-27793896 CCCCTGGGTGCTTGGGTCCCGGG - Intronic
1146268089 17:31466278-31466300 TCCCGGGCTGCCTGGGTCCAGGG - Intronic
1146837729 17:36125766-36125788 CCCCAGTGTGGCTGAGTCCAAGG + Intergenic
1147732033 17:42610015-42610037 GGACTGGGCGCCTGCGTCCAGGG - Intronic
1147993985 17:44351449-44351471 CCCCTGGGTACCTGGGTAAAAGG - Exonic
1148079732 17:44961009-44961031 GGCCTGGGTGCCAGCCTCCATGG + Intronic
1148102971 17:45103947-45103969 CCCATGGGAGGCTGCGTCCCGGG - Intronic
1148350607 17:46939316-46939338 CCCCTAGGTAGCTGCTTCCAGGG - Intronic
1151403912 17:73874564-73874586 CACCTGGGCTCCTGCCTCCAAGG + Intergenic
1151697502 17:75725032-75725054 CCTCTGGGTGCCTCAGTCCTGGG - Intronic
1151786531 17:76277945-76277967 TCACTGGGTGCCTGCTCCCATGG + Intronic
1151815491 17:76469555-76469577 CCCCTGGGTGCCTGTGGTCAGGG - Intronic
1151957043 17:77385657-77385679 CCCCTGACTGCCAGCGACCAGGG - Intronic
1152190238 17:78883669-78883691 CCACTGGGTGCCCGTCTCCATGG + Intronic
1152226732 17:79096247-79096269 CCCCTGGGTGCCTGTGCTCCAGG - Intronic
1152512938 17:80802705-80802727 CACCTGGGAGCCTGCCTTCAAGG - Intronic
1152715848 17:81900263-81900285 CCTCTGGGTGCCTGTGTTCTCGG + Intronic
1154062009 18:11070987-11071009 ACCCGTGGTGCCTGCTTCCATGG + Intronic
1154121982 18:11659464-11659486 CCCTGGGGTGCATGAGTCCAAGG + Intergenic
1155261025 18:24042542-24042564 CCCCTGGGTCGCAGGGTCCATGG - Intronic
1156834181 18:41532541-41532563 TCCCTAGGAGCCTGCGTCCCAGG + Intergenic
1157195958 18:45620212-45620234 CCCTTGAGCGCCTGGGTCCAGGG - Intronic
1157480519 18:48050697-48050719 CCCAGGGGTGCCTGCTTCCTGGG - Intronic
1157594643 18:48857143-48857165 CCCAGGGGTGCCTGAGTCAATGG + Intronic
1157649365 18:49312501-49312523 TCCCTGTGTGGCTGGGTCCAGGG - Intronic
1158511575 18:58095248-58095270 CCCCTCTTTGCCTGCCTCCATGG - Intronic
1160672600 19:373415-373437 CCCCCGGCTGCCGGCCTCCAGGG - Intronic
1161554540 19:4933151-4933173 CCCCTGAGTGCCTCTGCCCAGGG + Intronic
1161769427 19:6223274-6223296 CCACTGGGTCCCTGGGTCCCAGG + Intronic
1161812001 19:6476524-6476546 TCCCTGGGTCCCTGGGTCCCTGG + Intronic
1161812648 19:6479425-6479447 TCCCTGGGTCCCTGGGTCCCTGG + Intronic
1162088516 19:8262534-8262556 CCCCTGGGGCCCTGCATCCTTGG - Intronic
1164540805 19:29120266-29120288 GCCCTGGGTGTCTGATTCCAAGG + Intergenic
1164722834 19:30444786-30444808 CCCCGAGGTGCCTGTGCCCATGG + Exonic
1165143949 19:33719666-33719688 CCCCAGGCTGTCTGGGTCCAGGG + Intronic
1165434122 19:35787437-35787459 CACCCGGGTGCCTGGGTCCCGGG + Exonic
1165936986 19:39395419-39395441 CCCTTGGGCTCCTGCCTCCAGGG - Intronic
1166298780 19:41902714-41902736 CTCCTAGGTGCCTGCGCCCTGGG + Intronic
1166866340 19:45840049-45840071 CCCCTGGTTGCCTCAGTACATGG - Intronic
1166917314 19:46204263-46204285 CCCCCGGGTGCCTGGGATCAGGG + Intergenic
1168241956 19:55092911-55092933 CCTCTCGGTGCCTGGGTCCCCGG + Intronic
1168649803 19:58085813-58085835 GCCCTGGGTGCCTGTCGCCAGGG - Intronic
925997337 2:9304116-9304138 GCCCTGGGTCCCTGCTTCCCTGG + Intronic
926394060 2:12423501-12423523 CCACTGGGTGGCTGACTCCAGGG + Intergenic
926473030 2:13285116-13285138 CTCCTGTGTGGCTGGGTCCAAGG + Intergenic
928098842 2:28423109-28423131 CCCCTTGGTACCTGCCCCCATGG - Intergenic
929589234 2:43134415-43134437 CCTCTGGGTGCTTGCTTGCAGGG + Intergenic
932773997 2:74516238-74516260 CGCGCGGCTGCCTGCGTCCATGG + Exonic
935354655 2:102187418-102187440 CCCCTGCGCGCCTGTGTCCTCGG - Intronic
937133971 2:119536308-119536330 CCCCTGCGTGTCTGGGTCTAAGG + Intergenic
938262475 2:129905662-129905684 TCCCTGGGTGCCTTCACCCATGG + Intergenic
942672428 2:178390473-178390495 CCCTTGGGTGCATGAATCCAAGG + Intronic
942858618 2:180582731-180582753 CCACTGGGTGCCAGGGGCCATGG + Intergenic
948790737 2:240375405-240375427 CCGCAGGGTGCCCACGTCCAGGG + Intergenic
1168935851 20:1664842-1664864 CCTCTGAGTGCCTGCGTGGAAGG - Intergenic
1168997610 20:2144846-2144868 GCCCTGTGTGCCGGGGTCCATGG + Exonic
1170737334 20:19023205-19023227 CCCCAGAGTGCCTGCGTCCATGG - Intergenic
1170831815 20:19849383-19849405 ACCTTGGGAGCCTGTGTCCATGG - Intergenic
1171316540 20:24200446-24200468 CCCTTGGGTGCCGGTGTCCTAGG + Intergenic
1173664627 20:44755426-44755448 CCCCTAGGTGCCTCGCTCCATGG - Intronic
1174339939 20:49889244-49889266 CCCCAGGGTGCCAGGTTCCAAGG - Exonic
1175256170 20:57648674-57648696 CCCCTGCCTGCCTGATTCCATGG - Exonic
1175974087 20:62701752-62701774 CCACTGGGTGCCTCCGTGCCAGG - Intergenic
1175974830 20:62705512-62705534 CCCTTGGGAGCGTGCTTCCAAGG + Intergenic
1176069290 20:63217682-63217704 GCCCTGAGTGCCTGCTTCCCAGG + Intergenic
1176096026 20:63344992-63345014 CCCCCGGGTGCCTGTGACCGGGG - Exonic
1178726204 21:35053764-35053786 CCCCTGGGTGCCTGCACAAATGG - Intronic
1179881394 21:44294592-44294614 ACCCTGGGTGCCAGCTTCGAGGG + Intronic
1180784093 22:18537240-18537262 CCCCTGGGTGCCGGGGTGAAGGG + Intergenic
1181240994 22:21476592-21476614 CCCCTGGGTGCCGGGGTGAAGGG + Intergenic
1181646177 22:24232783-24232805 GCCCTGGGTTCCTGGGTTCAAGG - Intronic
1183205662 22:36417232-36417254 CCCCTTGCTGCCTGTGTCCCTGG - Intergenic
1183291022 22:37002147-37002169 CCCCTGGGAGCCAGCGCTCAAGG - Exonic
1185069969 22:48650822-48650844 CACCTGGGTGCCTGCCTCAGAGG - Intronic
1185168434 22:49276698-49276720 CCCCTGTGTGCCTGTGCCCATGG + Intergenic
1185270444 22:49927117-49927139 CCCTTGGATGGCTGCGTCCGGGG + Intronic
951642005 3:24846687-24846709 CCCCTGAGTGGCTGCTTCCCTGG + Intergenic
953926463 3:46985171-46985193 CCGCTGGATGCCTGGGCCCAAGG - Intronic
954447630 3:50555232-50555254 CCTCTGGGAGCCTGGGGCCAAGG - Intergenic
954539460 3:51384330-51384352 CTCCTGGCTGCCTGCCTTCAAGG - Intergenic
955392783 3:58533497-58533519 CTCCTGGGTGGCTGCGTCATAGG + Exonic
961386454 3:126525728-126525750 CACCTGAGTGCCTGGGTCCCGGG + Intronic
961628832 3:128281746-128281768 CCCCTGAGTGCCTGCCTCAGAGG - Intronic
962280468 3:134048425-134048447 CCCCTTGATCCCTGGGTCCACGG + Intronic
962307854 3:134304494-134304516 TCCCTGTGTGGCTGGGTCCAGGG + Intergenic
963746279 3:149127892-149127914 CCTCTGTGTGCCTGCATCCCTGG - Intergenic
965613210 3:170566173-170566195 CCTCTGGGTGCTTGCTTCCTCGG + Intronic
966989553 3:185215478-185215500 TCACTGGTTGCCTGCGGCCAAGG + Intronic
967178975 3:186886597-186886619 CCCCTGGGTTGCTGAGACCAAGG - Intergenic
967888226 3:194347377-194347399 TCCCTGGGTGTCTGGGGCCAGGG - Intronic
968634796 4:1672344-1672366 TTCCTGGGTTCCTGGGTCCATGG - Intronic
969081461 4:4621747-4621769 CCCCTCTGTGCCTTCGCCCATGG + Intergenic
972110961 4:35559571-35559593 CGCCTGAGTGCCTGAGTCCAGGG - Intergenic
975776395 4:77792259-77792281 TCCCTAGGTGCCTACATCCATGG + Intronic
978249128 4:106610009-106610031 CCCCTGGGTGCCAGCGCCACAGG + Intergenic
981429787 4:144645855-144645877 CCCCCGGGTGGGGGCGTCCACGG - Intergenic
981940894 4:150280623-150280645 CCCCAGGCTGCCTGCCTGCAGGG + Intronic
982026703 4:151258829-151258851 TCCCTGGGATCCTGAGTCCAGGG + Intronic
982950737 4:161692604-161692626 CCCCTGGGTGAATGTGTCCAGGG + Intronic
983692119 4:170482744-170482766 CCCTTGGGTGCCTCGGGCCATGG + Intergenic
984567300 4:181346472-181346494 CCCCGTGGTGGCTGCTTCCAAGG - Intergenic
985664234 5:1173689-1173711 CCCAGAGGTGCCTGCGGCCAGGG - Intergenic
986658176 5:10035670-10035692 TCCCTGGGTGCCTGTGTTTAGGG - Intergenic
987324161 5:16796948-16796970 CCCCTGGGTGTATGCATCCCTGG - Intronic
994273572 5:97809442-97809464 CCCCAGTGTGGCTGAGTCCAGGG + Intergenic
996703403 5:126472386-126472408 CCCCTTGGTGACTCAGTCCATGG - Intronic
997977396 5:138448417-138448439 CCCCTGGGTTCCGGCTTCCCGGG - Intergenic
999125818 5:149245024-149245046 CCCATAGGAGCCTGGGTCCAGGG + Intronic
1002457042 5:179351175-179351197 CCCCTGGGTCCCTGGCTGCAGGG - Intergenic
1002636086 5:180609532-180609554 GACCTGGGTTCCTGCCTCCAGGG - Intronic
1003443773 6:6166603-6166625 AGCCTGGGTTCCTGCTTCCAGGG + Intronic
1003774172 6:9340637-9340659 CCCCTGGGAGCAGGCGTCAATGG - Intergenic
1006456205 6:34133403-34133425 CCCCTGGATGCCTTCCTCCCTGG - Exonic
1007790222 6:44304447-44304469 CCCCTGAGTGCCTGCGGTTAGGG - Exonic
1011318995 6:86069460-86069482 CCCCTGGCAGCTTGGGTCCAGGG + Intergenic
1016882408 6:148923772-148923794 CTCCTGGGGGCCTTTGTCCAGGG + Intronic
1018479874 6:164179708-164179730 CCCCTTGATGCCTGTTTCCACGG + Intergenic
1018861961 6:167717531-167717553 CACCTGGGTGCTTGCGCCCGAGG + Intergenic
1019631174 7:2050608-2050630 TGCCTGGGTCCCTGTGTCCATGG - Intronic
1019634285 7:2067217-2067239 ACCCCGGGTGCCTGCGAACATGG - Intronic
1021881312 7:25097773-25097795 CTCGTGGGTGTCTGTGTCCAGGG - Intergenic
1024035909 7:45507032-45507054 CCCCTGGATGCCTGGCTCCCTGG + Intergenic
1026400962 7:70012279-70012301 CCCCTGGGCCCTGGCGTCCAGGG + Intronic
1029995262 7:105001236-105001258 CCCCTGGGGGCCTCCTTCCCTGG - Intergenic
1030315236 7:108107369-108107391 CTTCTGGGTGCCTGGGGCCATGG + Intronic
1030593462 7:111508599-111508621 CCCCAGTGTGGCTGGGTCCAGGG + Intronic
1034228128 7:149498098-149498120 CCCCCGGGTGACCGCGGCCAGGG + Intergenic
1034447564 7:151121393-151121415 CCCTTAGGTGCCTCTGTCCACGG + Intronic
1035021010 7:155800442-155800464 CCCCAAGGTGCCTGAGGCCATGG - Exonic
1036808979 8:11854201-11854223 CTCCTGGGCGCCTGCATCCAGGG + Intronic
1037804365 8:22050770-22050792 TCCCTGGGTCCCTGGGTCCCTGG + Intronic
1038004432 8:23417804-23417826 CCCCTGGGTGTCTACATCCAGGG - Intronic
1038562969 8:28596491-28596513 CCCCTGTGTGGCTGGGTCCGAGG + Intergenic
1038662154 8:29506664-29506686 CCCCTGGGACCCTGTGTCCCAGG - Intergenic
1044414853 8:91926035-91926057 TCCCAGGGTGGCTGAGTCCAGGG - Intergenic
1044593940 8:93940637-93940659 TCCCTGCGTGGCTGGGTCCAGGG + Intergenic
1047299619 8:123601925-123601947 CCCCTGGGTGCCTGTGTACTTGG + Intergenic
1048795772 8:138148528-138148550 CACCTGGTTGTCTGTGTCCATGG - Exonic
1048981853 8:139706635-139706657 CCTCTGCGTGCCTGCCTCCCTGG + Intergenic
1049316772 8:141973466-141973488 CCTCACGGTGCCTGCGTTCACGG + Intergenic
1049318957 8:141985744-141985766 GGCCTTGGTGCCAGCGTCCAGGG - Intergenic
1053288451 9:36864713-36864735 CCCCTGGGAGCCTGCCGCCAGGG + Intronic
1054761314 9:69006644-69006666 CCCCTGGGGTCCTGGCTCCAGGG + Intronic
1055375797 9:75647507-75647529 CCCATGGGTGCGTCCGTCTAAGG - Intergenic
1055607623 9:77987290-77987312 CCTCTGGGTGCTTGCTTTCAAGG + Intronic
1061750013 9:132770776-132770798 CCACTGGGTTCCTGGATCCAGGG - Intronic
1062424767 9:136500974-136500996 CCCCTTGGTGGCTGTGTGCACGG - Intronic
1185881631 X:3746485-3746507 CCCCTGAGTAGCTGGGTCCATGG + Intergenic
1192034113 X:67545254-67545276 CCTCTGGGTGCCTGGGGCCCGGG - Exonic
1196602121 X:117613861-117613883 CCCCTCGGTGCCTGTCCCCATGG + Intergenic
1197746078 X:129932715-129932737 CCGCGAGGTGCCTGCGGCCACGG - Intergenic
1198236279 X:134738524-134738546 TCTCTGGGTACCTGGGTCCAGGG - Intronic
1199701227 X:150377204-150377226 CACCAGGGTGCCTCCCTCCAAGG - Intronic
1201564082 Y:15347799-15347821 CCCTTGGGTGCCTGCGTGTAAGG - Intergenic