ID: 902819993

View in Genome Browser
Species Human (GRCh38)
Location 1:18937927-18937949
Sequence TCTCAACTCCAACCCAGCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 91
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 84}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902819985_902819993 17 Left 902819985 1:18937887-18937909 CCCAGCTATGCAAAAGAACCGGC 0: 1
1: 0
2: 0
3: 6
4: 46
Right 902819993 1:18937927-18937949 TCTCAACTCCAACCCAGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 84
902819983_902819993 18 Left 902819983 1:18937886-18937908 CCCCAGCTATGCAAAAGAACCGG 0: 1
1: 0
2: 0
3: 4
4: 97
Right 902819993 1:18937927-18937949 TCTCAACTCCAACCCAGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 84
902819988_902819993 -7 Left 902819988 1:18937911-18937933 CCAGCACAGCCTCTCTTCTCAAC 0: 1
1: 0
2: 2
3: 15
4: 361
Right 902819993 1:18937927-18937949 TCTCAACTCCAACCCAGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 84
902819986_902819993 16 Left 902819986 1:18937888-18937910 CCAGCTATGCAAAAGAACCGGCA 0: 1
1: 0
2: 0
3: 4
4: 50
Right 902819993 1:18937927-18937949 TCTCAACTCCAACCCAGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 84
902819987_902819993 -1 Left 902819987 1:18937905-18937927 CCGGCACCAGCACAGCCTCTCTT 0: 1
1: 0
2: 6
3: 53
4: 404
Right 902819993 1:18937927-18937949 TCTCAACTCCAACCCAGCGGGGG 0: 1
1: 0
2: 0
3: 6
4: 84

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902819993 Original CRISPR TCTCAACTCCAACCCAGCGG GGG Intronic
901187827 1:7386504-7386526 TCTCATCTCCCACCCCACGGTGG + Intronic
902183030 1:14704123-14704145 TTTCCACTCCATCCCAGGGGAGG - Intronic
902386111 1:16076817-16076839 TCTCCACTCTAGCCCAGCAGCGG - Intergenic
902819993 1:18937927-18937949 TCTCAACTCCAACCCAGCGGGGG + Intronic
912993558 1:114511454-114511476 TATGAACTCCGACACAGCGGTGG + Intergenic
915644825 1:157262569-157262591 TCTCTCCCCCAACCCAGCTGTGG + Intergenic
1067662749 10:48248894-48248916 TCTCAACACCAAGCCAGAGTGGG - Intronic
1067676006 10:48377598-48377620 TCTCTTCTCCAATCCAGGGGAGG - Intronic
1068135344 10:52947521-52947543 CCTTAACTGCAACTCAGCGGGGG + Intergenic
1070281141 10:75049786-75049808 TCTCAACGCCAGGCCAGCTGTGG + Intronic
1077161553 11:1115092-1115114 TCTCAAGTCCCAGCAAGCGGAGG - Intergenic
1080585627 11:33679879-33679901 TCCAAACCCCAACCCAGCAGAGG - Intergenic
1081041443 11:38219559-38219581 TCTCAACTCCACCCCACTGTAGG - Intergenic
1083101538 11:60311691-60311713 GCCCAACTTCAACCCAGCAGGGG - Intergenic
1083900730 11:65642064-65642086 TCTCAACCCTGACCCAGAGGTGG - Intronic
1085305673 11:75484395-75484417 TCTCCACTCCTACCCAGGCGTGG + Intronic
1086325604 11:85695619-85695641 TGTCATCTCCAACCCAGTGCAGG - Intronic
1093993420 12:25615367-25615389 TCTGAACTCCAAGCCAGAGAAGG + Intronic
1101577811 12:106014116-106014138 GCTCATCTCCAACCCAGTGGAGG + Intergenic
1102627256 12:114244990-114245012 TCTCATCTCCTTCCCAGTGGGGG + Intergenic
1104766542 12:131333696-131333718 TCCCAACTCCACATCAGCGGTGG - Intergenic
1113729963 13:112634318-112634340 TCTCAGCTCCAACCTCCCGGGGG - Intergenic
1113914625 13:113863230-113863252 CCTCACCTCCAGCCCAGCAGAGG + Intronic
1114523914 14:23356269-23356291 TCTGAACTGAAACCCAGAGGAGG - Intergenic
1118929746 14:70230375-70230397 TCTCAACTCCACCCCTCCTGTGG - Intergenic
1121250260 14:92494054-92494076 TGTCACCTCCAGCCCAGAGGTGG + Exonic
1121927884 14:97945886-97945908 TCTCTACTGCACCCCAGGGGGGG - Intronic
1123006466 14:105326223-105326245 TCTCAACTCCACTGCTGCGGGGG - Intronic
1125725418 15:41866009-41866031 TCTCAGCCCCCACCCAGCTGGGG + Intronic
1129350711 15:74954606-74954628 GCCCAACTCCAAGCCAGCTGGGG - Exonic
1132683900 16:1154302-1154324 TCTCCCCTCCAAGCCCGCGGGGG - Intronic
1133473364 16:6096847-6096869 TGCCAACTCCTTCCCAGCGGAGG - Intronic
1135913021 16:26578552-26578574 ACTCAATTTCAACCCAGCAGAGG - Intergenic
1138586131 16:57971450-57971472 TGTCAGCTCCCACTCAGCGGTGG + Intergenic
1141428740 16:83960040-83960062 CCTCATCTCCAACTCAGGGGCGG - Intronic
1142355768 16:89601070-89601092 TCTCAAATCCACCCCCGAGGAGG - Intergenic
1143055080 17:4156458-4156480 TCCCCACTACAACCCAGCGCAGG - Intronic
1143263925 17:5621502-5621524 TCTCCTCTCCCAGCCAGCGGGGG - Intergenic
1146782958 17:35692569-35692591 TCTCAAATTCAATCCAGCTGAGG - Intronic
1151966853 17:77436071-77436093 ACTCAACTCCCACCCAGCCGTGG - Intronic
1152467089 17:80472628-80472650 TCTCAAGTCCAGGCCAGCAGTGG - Intronic
1155177541 18:23313889-23313911 TCTGATCTCCAACCCAGGGAAGG + Intronic
1158774102 18:60555694-60555716 CCTCAACTTCAAGCCAGGGGTGG + Intergenic
1159477528 18:68942642-68942664 TCTCAACTCCAGCCCTAAGGCGG + Intronic
1160024097 18:75204702-75204724 TCTCAACTCCACCGCGGCGCCGG - Intronic
1160395928 18:78572255-78572277 TCTCATCTCCTACCCAGCACAGG - Intergenic
1160923081 19:1529629-1529651 TCTCATCCTCAACCCAGAGGCGG - Intronic
1161574587 19:5048571-5048593 TTACAACTCCAACCCAGGGAAGG - Intronic
1161728836 19:5946552-5946574 TCTCCACTAAGACCCAGCGGAGG + Intronic
1162066892 19:8131399-8131421 ACACAACTCCAACCCCGGGGAGG + Intronic
1167997866 19:53421093-53421115 TCTCACCTCCAGCCCTGAGGCGG - Intronic
926913474 2:17872525-17872547 TCCCAACTCTAAGCCAGAGGAGG - Intergenic
928430913 2:31217753-31217775 TCTCACTTCCAACCCTGGGGAGG + Intronic
931204930 2:60137712-60137734 CCTCACTTCCAACCCAGCAGAGG + Intergenic
933433226 2:82212078-82212100 TCCAAACTCAAACCCAGCAGAGG - Intergenic
946321884 2:218959402-218959424 TCTCAACTCTGACCCTGAGGAGG + Intergenic
948473527 2:238202502-238202524 TCCCCAGGCCAACCCAGCGGGGG - Intronic
1170745722 20:19097437-19097459 TCTCTCCTGCAGCCCAGCGGGGG - Intergenic
1171783282 20:29440662-29440684 TCTCAACTCCAGCCCTAAGGCGG + Intergenic
1179248394 21:39652502-39652524 TCTCAGCTCAAACACAGTGGTGG - Intronic
1181616033 22:24055044-24055066 TGTCAGCACCAACCCAGCTGTGG + Exonic
1183348958 22:37324133-37324155 GCTCAACTCAAACCCTGTGGTGG + Intergenic
1183350506 22:37332133-37332155 CCTCAAGTCCAGCCCAGCAGGGG + Intergenic
949743129 3:7259433-7259455 TCCCAACTTCAACCCAGTGGAGG + Intronic
969607612 4:8210318-8210340 TCTCCATTCCTCCCCAGCGGGGG - Intronic
985826312 5:2194106-2194128 TCTCAACTCCAGCCTAGAGGAGG + Intergenic
987019003 5:13850716-13850738 TCTCATCTCCAACACAGCACTGG + Exonic
987088550 5:14490661-14490683 TCTCACCACCAACCCACCAGTGG - Intronic
990900526 5:60744169-60744191 TCTCAACCTCAGCCCAGCTGCGG + Intergenic
994936484 5:106259543-106259565 TCTCACCTCCAACCCTAAGGCGG + Intergenic
997666271 5:135631927-135631949 TTTGAAGTCCAACCCAGGGGAGG + Intergenic
1000978212 5:167787877-167787899 TCTCAGCTCTACCACAGCGGTGG - Intronic
1001036743 5:168302262-168302284 TATCACGTCCCACCCAGCGGGGG + Intronic
1006195097 6:32235269-32235291 CATCAACTCCCACCCAGCTGAGG - Intergenic
1017507096 6:155078648-155078670 TCTGAACTCCCACCCAGGAGAGG + Intronic
1019590466 7:1827900-1827922 TCTCACCTCCCACCCAGGCGAGG + Intronic
1021969477 7:25951750-25951772 TCTCAACTCCCTGCCAGGGGAGG - Intergenic
1026008623 7:66619331-66619353 TCTCACCTCCAACCCTAAGGTGG + Intergenic
1026896761 7:74013898-74013920 TCTCGACTCCTCCCCAGAGGCGG + Intergenic
1028325469 7:89518775-89518797 TTTTAACTCCAAACCAGTGGAGG - Intergenic
1030375990 7:108754337-108754359 TCTCAATTCTAAACCAGGGGAGG + Intergenic
1034336054 7:150324247-150324269 TCTCAACTCCAGCACTGCAGGGG - Intronic
1035017197 7:155776899-155776921 TCACCACTCCAACGCAGCTGTGG - Exonic
1039493387 8:37964387-37964409 TCCCTACTCCAACCCAGCCCAGG + Intronic
1048458644 8:134601678-134601700 TCTCAGGTCAAACCCAGCTGAGG - Exonic
1052180442 9:25519610-25519632 ACTCAACTCCAACCCAACTCTGG + Intergenic
1061900841 9:133671216-133671238 CCTCAATTCCAACCCAGCCTGGG + Intronic
1062444474 9:136587922-136587944 TCCCAACCCCAACCCAGCCCTGG + Intergenic
1203443311 Un_GL000219v1:31537-31559 TCTCAACTCCAGCCCTGAGGTGG + Intergenic
1203514119 Un_KI270741v1:150446-150468 TCTCAACTCCAGCCCTGAGGTGG + Intergenic
1200219635 X:154384704-154384726 TCGTACCTCCAACCCAGCTGAGG - Intergenic