ID: 902820067

View in Genome Browser
Species Human (GRCh38)
Location 1:18938323-18938345
Sequence CCTTCCCAGCAGCTGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 512
Summary {0: 1, 1: 0, 2: 3, 3: 41, 4: 467}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902820067_902820084 26 Left 902820067 1:18938323-18938345 CCCACCTCCAGCTGCTGGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 467
Right 902820084 1:18938372-18938394 GCTACAGCGTCCAGGGCCCCGGG 0: 1
1: 0
2: 0
3: 10
4: 196
902820067_902820079 0 Left 902820067 1:18938323-18938345 CCCACCTCCAGCTGCTGGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 467
Right 902820079 1:18938346-18938368 CTGGGAGGGAGGCTACTGGGAGG 0: 1
1: 0
2: 1
3: 48
4: 435
902820067_902820080 1 Left 902820067 1:18938323-18938345 CCCACCTCCAGCTGCTGGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 467
Right 902820080 1:18938347-18938369 TGGGAGGGAGGCTACTGGGAGGG 0: 1
1: 0
2: 0
3: 56
4: 510
902820067_902820078 -3 Left 902820067 1:18938323-18938345 CCCACCTCCAGCTGCTGGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 467
Right 902820078 1:18938343-18938365 AGGCTGGGAGGGAGGCTACTGGG 0: 1
1: 0
2: 2
3: 31
4: 397
902820067_902820083 25 Left 902820067 1:18938323-18938345 CCCACCTCCAGCTGCTGGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 467
Right 902820083 1:18938371-18938393 TGCTACAGCGTCCAGGGCCCCGG 0: 1
1: 0
2: 1
3: 12
4: 137
902820067_902820077 -4 Left 902820067 1:18938323-18938345 CCCACCTCCAGCTGCTGGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 467
Right 902820077 1:18938342-18938364 AAGGCTGGGAGGGAGGCTACTGG 0: 1
1: 0
2: 3
3: 32
4: 474
902820067_902820081 18 Left 902820067 1:18938323-18938345 CCCACCTCCAGCTGCTGGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 467
Right 902820081 1:18938364-18938386 GGAGGGCTGCTACAGCGTCCAGG 0: 1
1: 0
2: 0
3: 29
4: 156
902820067_902820082 19 Left 902820067 1:18938323-18938345 CCCACCTCCAGCTGCTGGGAAGG 0: 1
1: 0
2: 3
3: 41
4: 467
Right 902820082 1:18938365-18938387 GAGGGCTGCTACAGCGTCCAGGG 0: 1
1: 0
2: 0
3: 11
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902820067 Original CRISPR CCTTCCCAGCAGCTGGAGGT GGG (reversed) Intronic
900135419 1:1115415-1115437 CCTTCCCGGCAGCCGGGAGTGGG - Intronic
900185970 1:1333388-1333410 CCTTCCCGGCAGGCGGGGGTGGG + Intronic
900565318 1:3329154-3329176 CTGTCCCAGCAGTTGTAGGTAGG + Intronic
900585224 1:3429402-3429424 GCTTCCCACCAGCTGGGGGCAGG - Intronic
900941177 1:5799568-5799590 GGTTCCCAGGAGCTGGGGGTGGG + Intergenic
901239998 1:7687372-7687394 CCCTCCAAGCAGGGGGAGGTGGG + Intronic
901658108 1:10782205-10782227 CATTCCCAGAAGCTGCAGGGAGG - Intronic
901789745 1:11647936-11647958 CCTTCCAAGCAGCTGGGGGAGGG + Intergenic
902239792 1:15080880-15080902 GCTCCCCAGCAGCTTGTGGTTGG + Intronic
902666246 1:17940876-17940898 CACTCCCAGCAGCTGGGGATGGG - Intergenic
902820067 1:18938323-18938345 CCTTCCCAGCAGCTGGAGGTGGG - Intronic
904108102 1:28103093-28103115 GGTTCCCAGAAGCTAGAGGTAGG + Intergenic
904900969 1:33856715-33856737 GCTGCCCAACAGCTGGAGGATGG + Intronic
905010660 1:34744973-34744995 TGTGCCCAGCAGCTGGAGGTGGG + Intronic
905520105 1:38591089-38591111 CCTTCCAAGCAGTTAAAGGTAGG + Intergenic
905819851 1:40980412-40980434 CCTTCCCGGCGGCCGGGGGTCGG + Intronic
906117150 1:43364560-43364582 GCTTCCCTGGAGCTGGTGGTGGG - Exonic
906195953 1:43930926-43930948 TCTTCCCAGCAGGCGGAGCTGGG - Exonic
906213280 1:44024167-44024189 CCTTCCAAGCAGCTGGCAGGAGG + Intronic
906984879 1:50672387-50672409 CATTTGGAGCAGCTGGAGGTGGG + Intronic
907469310 1:54662422-54662444 GCTTCTCAGCAGGTTGAGGTGGG + Intronic
908037658 1:60073629-60073651 CCTGCCCAGCAGCTGCGTGTCGG + Intronic
908338996 1:63157082-63157104 CCTCTCCAGCTGCTGGAGGCTGG + Intergenic
908727672 1:67194256-67194278 TCTTCCCAGGAGATGGGGGTGGG + Intronic
912306064 1:108568792-108568814 CCTTCCCAGTGGCTGGAATTCGG - Intronic
913671911 1:121105000-121105022 CCTCCCCGGAAGTTGGAGGTGGG + Intergenic
914023686 1:143892445-143892467 CCTCCCCGGAAGTTGGAGGTGGG + Intergenic
914662162 1:149800392-149800414 CCTCCCCGGAAGTTGGAGGTGGG + Intronic
915070931 1:153266236-153266258 GGTTACCAGGAGCTGGAGGTGGG - Intergenic
916177547 1:162055277-162055299 CCTTCCCAGCACCTCTAGGGAGG + Intergenic
916559804 1:165924916-165924938 CCTTCAGAACAGCTGGAGGACGG + Intergenic
919664923 1:200282753-200282775 CTTTCTCAGCAGCAGGAGGGAGG + Intergenic
920070137 1:203296758-203296780 CCCTCCCAGCAGCAGGAGAGTGG + Intergenic
920077562 1:203348238-203348260 CCCTGCCAGCAGCAGGAGGGAGG + Exonic
920106677 1:203558145-203558167 GCTTGCAAGCAGCTGGAGCTAGG - Intergenic
920118319 1:203636963-203636985 AGTTCCCGGCAGGTGGAGGTGGG - Intronic
920268888 1:204747900-204747922 CATCTCCTGCAGCTGGAGGTTGG - Intergenic
920379007 1:205525048-205525070 CCCTCCCAGAGGCTGGAGTTGGG + Intronic
920388269 1:205582883-205582905 CCTTCCCTGCCCCTGGAGGCAGG - Intronic
920414968 1:205793092-205793114 CCTTTCCAGCAGCTGCAGAAGGG + Intronic
924104593 1:240637619-240637641 CCTACCAAGCTGCTGGAGTTTGG + Intergenic
924236121 1:242000854-242000876 CCTCCCCAGAGGCTGGAGGTGGG + Intergenic
1063785980 10:9382947-9382969 CCTCCCCAGGCACTGGAGGTAGG - Intergenic
1064614771 10:17141454-17141476 CCTTAAAAGCAGCTGGAGGCTGG - Intergenic
1066785230 10:38995898-38995920 TATGCTCAGCAGCTGGAGGTAGG + Intergenic
1067371745 10:45690403-45690425 TATGCTCAGCAGCTGGAGGTAGG + Intergenic
1067388036 10:45835746-45835768 TATGCTCAGCAGCTGGAGGTAGG - Intronic
1067418085 10:46121534-46121556 TATGCTCAGCAGCTGGAGGTAGG + Intergenic
1067446229 10:46348855-46348877 TATGCTCAGCAGCTGGAGGTAGG + Intergenic
1067503444 10:46828097-46828119 TATGCTCAGCAGCTGGAGGTAGG + Intergenic
1067591149 10:47511916-47511938 TATGCTCAGCAGCTGGAGGTAGG - Intronic
1067638267 10:48020008-48020030 TATGCTCAGCAGCTGGAGGTAGG - Intergenic
1067793509 10:49304731-49304753 CCTTCCCAGGGGCTGGAGAAAGG + Intronic
1067875227 10:50000353-50000375 TATGCTCAGCAGCTGGAGGTAGG + Intronic
1069599601 10:69694968-69694990 GAGTCCCAGCAGCTGGAGGATGG - Intergenic
1069813579 10:71179714-71179736 CCCTCCCAGGTGCTGGAGGCAGG + Intergenic
1069906292 10:71734496-71734518 CCTTCCCAGCAGGTTGGGCTAGG + Intronic
1069909053 10:71748823-71748845 CCTCCCCAGCAGCAGCAGGGAGG + Exonic
1070011457 10:72478930-72478952 CCTTCCCAGCAATTGAAGGCTGG - Intronic
1070134872 10:73684434-73684456 TATGCTCAGCAGCTGGAGGTAGG - Intronic
1070423494 10:76262125-76262147 GCTACCCAGGAGGTGGAGGTGGG + Intronic
1070599078 10:77853349-77853371 CGTGCCCAGCAGCAGCAGGTAGG - Exonic
1070836158 10:79448171-79448193 CATTCCCAGCAGCTGGCTGAGGG - Intergenic
1070992979 10:80748990-80749012 CCCTTCCATCAGCTGTAGGTAGG + Intergenic
1072944427 10:99797001-99797023 CTATCCCAGAACCTGGAGGTAGG + Intronic
1073258429 10:102170514-102170536 CCCTGCCAGGACCTGGAGGTAGG - Intergenic
1074110269 10:110417776-110417798 CCATCCCTGCAGCTGGAGTCTGG - Intergenic
1074451524 10:113563606-113563628 CCTTCCTAGGAGCTGGCGCTCGG - Intronic
1074696176 10:116051799-116051821 CCTTCCCAGCTGATGGGGCTGGG + Intergenic
1075715742 10:124554295-124554317 CCTACCCAGGAGGCGGAGGTGGG - Intronic
1076046646 10:127299601-127299623 CCTTGCCAGCACCTGGATTTGGG + Intronic
1076353419 10:129834175-129834197 CCTTCCAAGTGGCTGGAGGCTGG - Intergenic
1076385792 10:130054183-130054205 GCTTGCCAGGAGCTGGAGGGAGG - Intergenic
1076592306 10:131592194-131592216 GGTTGCCAGCAGCTGGGGGTTGG - Intergenic
1077009006 11:371835-371857 CCCTCACACCTGCTGGAGGTTGG + Intronic
1077015553 11:397592-397614 CGCTCCCAGCACCTGCAGGTTGG - Exonic
1077102522 11:828470-828492 CCTTCCCACCTGCTGCAGGGAGG + Intronic
1077429805 11:2510763-2510785 CCTTCCCAGGACCTGGAGGCAGG - Intronic
1078187880 11:9067951-9067973 CCTTCCGAAGATCTGGAGGTGGG + Intronic
1078741197 11:14067722-14067744 CCTTCCTTGCTGCTGGTGGTAGG - Intronic
1078858589 11:15226708-15226730 CCATGCCAGCAGCTGCAGGAAGG + Intronic
1080878988 11:36301576-36301598 CCTTCCCAGCTGGAGGAAGTGGG + Intronic
1081481175 11:43490544-43490566 CCTTCCCAGCTTCAGCAGGTTGG + Intronic
1082676566 11:56112360-56112382 CCATGCCAGCAGCTGGAACTTGG + Intergenic
1083401497 11:62426361-62426383 CCTGCCCTGCAGGTGGTGGTGGG + Intergenic
1083925081 11:65801208-65801230 CGTTCCCAGCAGCTGGGGCATGG - Intergenic
1084036463 11:66514394-66514416 CTCTCCCTGCAGCTGGTGGTAGG + Exonic
1084403339 11:68957158-68957180 TCTTCACAGCAGCTGGAGGTGGG + Intergenic
1084409800 11:69000150-69000172 CCCTCCCAGGAGCTGGAGGCAGG - Intergenic
1084420059 11:69055988-69056010 TCCTCCCACAAGCTGGAGGTGGG + Intronic
1084767513 11:71322441-71322463 CCTGTCCAGCAGGTGGAGGTTGG - Intergenic
1085149696 11:74240047-74240069 CCTCCCCAGTAGCTGTAGCTGGG + Intronic
1086289155 11:85286445-85286467 CCTTCTCAGCAGATGGAGCAAGG - Intronic
1086453395 11:86938721-86938743 CCTTCCGAGGGGCTGGGGGTAGG + Intronic
1087004260 11:93453657-93453679 CTCTCCCAGCTGCTGGTGGTTGG - Intergenic
1087990534 11:104742361-104742383 CCTTCCCAGAAGATTGAAGTAGG + Intergenic
1089104470 11:115990741-115990763 GCTCCCCAGCAGCTGGAAGGAGG - Intergenic
1089307235 11:117534236-117534258 GATTCTCAGCACCTGGAGGTGGG + Intronic
1090238380 11:125165469-125165491 GCTTTCCAGCGGCTGGAGGCGGG + Intronic
1090628564 11:128626805-128626827 GGTTCCCAGTAGCAGGAGGTGGG + Intergenic
1091510758 12:1123024-1123046 CCATCTCACCAGCTGGAGCTGGG - Intronic
1091642797 12:2250294-2250316 ACCTCCCAGCACCTGGAGTTGGG + Intronic
1091726028 12:2847020-2847042 GCTTCCCAGATGCTGGAGGAGGG - Intronic
1091770520 12:3148425-3148447 CCTTTCCAGCAGCTCGGGCTGGG + Intronic
1093885386 12:24453683-24453705 CTTTCCTAGCTGCTGGATGTAGG - Intergenic
1094835149 12:34318773-34318795 CCTTCCCAGCAGCCCCAGCTCGG - Intergenic
1094835556 12:34320455-34320477 CCTTCCCAGCAGCCCGAGCAGGG - Intergenic
1094835941 12:34322121-34322143 CCTTCCCAGCAGCTGCTGCATGG - Intergenic
1095511405 12:42954908-42954930 CCTACCCAGCAAGTGGAGTTTGG + Intergenic
1096708663 12:53439449-53439471 CCTTGCCAGCATCTGGATTTTGG - Intergenic
1097334934 12:58371617-58371639 CCTTCCCTGCACCTTGGGGTGGG - Intergenic
1097961979 12:65541209-65541231 ACTTCCCAGCACCTGGATTTAGG + Intergenic
1098240340 12:68460742-68460764 GCTACCCAGCTACTGGAGGTGGG - Intergenic
1099286362 12:80717538-80717560 CCATCAGAGCAGTTGGAGGTGGG - Exonic
1100475825 12:94934460-94934482 CCTTTCCAACAGCTGGAAATTGG + Intronic
1100745210 12:97638157-97638179 TCTTCCCAGGAGCCAGAGGTGGG + Intergenic
1101397418 12:104360461-104360483 CCCACCCAGCAGATGGAGGTGGG - Intergenic
1101495699 12:105252141-105252163 CATTGCCAGGAGCTGGAGGGAGG + Intronic
1101949977 12:109167045-109167067 CCCTCCTCTCAGCTGGAGGTGGG + Intronic
1102158714 12:110751319-110751341 CTATCCCAGCATCTGGAGGGTGG + Intergenic
1102723018 12:115034272-115034294 ACCTCCCAGCAACTGGAGCTGGG - Intergenic
1103623119 12:122200804-122200826 CCGGCCCAGCACCTGGAGGATGG - Exonic
1103925988 12:124423559-124423581 CCTTGCCAGCCGCCCGAGGTGGG - Intronic
1104196466 12:126543796-126543818 CCCTCCCAGCAGCTGGGGCAGGG - Intergenic
1104276863 12:127337003-127337025 CCACCTCTGCAGCTGGAGGTGGG - Intergenic
1105892297 13:24690377-24690399 CCTTCAGAGCAGCTGGTGGTGGG + Exonic
1106080411 13:26495952-26495974 CCCTGCCAGCATCTGCAGGTGGG - Intergenic
1106131219 13:26941071-26941093 CCCTTCCAGCAACTGGAAGTGGG - Intergenic
1106449317 13:29865471-29865493 CATACCCAGGAGCTGGAGGCAGG - Intergenic
1107076965 13:36332380-36332402 CCTCCCAAGGAGCTGGAGCTAGG - Intronic
1107821058 13:44286088-44286110 CCTTCCCAGAAGCTCCAGGCTGG + Intergenic
1108396708 13:49997114-49997136 CTTTCCCACTAGCCGGAGGTCGG + Exonic
1109803388 13:67405026-67405048 ACTTGCTAGCAGCTGAAGGTGGG + Intergenic
1110288691 13:73779302-73779324 CCTTTCTAGAAGTTGGAGGTTGG - Intronic
1111711116 13:91815618-91815640 CATTGACAGCAGCTGGAGGGAGG - Intronic
1113008676 13:105737929-105737951 CCTGCCCAGCACCAGCAGGTAGG + Intergenic
1113931873 13:113972940-113972962 CCTTCCCAGCAGCCCTGGGTGGG + Intergenic
1116819854 14:49617320-49617342 CCTTCCTAGTAGCTGTAGCTAGG - Intergenic
1117722213 14:58638581-58638603 CCTGCCCAGGGGCTGGAGGTCGG + Intronic
1117756281 14:58977708-58977730 CCTTCCCTGAAGATGGAGTTGGG + Intergenic
1117985443 14:61381932-61381954 TCTTCCCAGCATCTGAATGTTGG + Intronic
1117994671 14:61467465-61467487 CCCTGCCAGCCGCTGGATGTGGG + Intronic
1118576943 14:67251869-67251891 CCTTCCCAGAGGTTGAAGGTGGG - Intronic
1119768158 14:77203807-77203829 CCCTGGCAGCAGCAGGAGGTGGG + Intronic
1121541546 14:94731040-94731062 CCTTCCCTCCACCTTGAGGTTGG + Intergenic
1121553457 14:94819482-94819504 CCTTCCCAGGTGCAGGAGCTGGG - Intergenic
1121643674 14:95502944-95502966 CACTCCAAGCTGCTGGAGGTCGG + Intergenic
1121797673 14:96748620-96748642 GCTTCCCAACAGCTGGAGTCTGG - Intergenic
1121964932 14:98295321-98295343 CTTTCCCAGCAGCAGCAGCTGGG - Intergenic
1122124426 14:99571393-99571415 TCATCACAGCAGCTGGAGCTGGG - Intronic
1122255228 14:100471414-100471436 ACTTACCAAAAGCTGGAGGTGGG - Intronic
1122299095 14:100722009-100722031 CCTTCCCAGAAGCTTGCTGTGGG + Intergenic
1122434589 14:101686294-101686316 GGTTCCCAGATGCTGGAGGTTGG + Intergenic
1122983212 14:105200774-105200796 TCTTGCCAGCTGCTGGAGGGTGG - Intergenic
1123586978 15:21769751-21769773 ACTTCCCAGAAGCTGAGGGTGGG + Intergenic
1123623617 15:22212316-22212338 ACTTCCCAGAAGCTGAGGGTGGG + Intergenic
1124986370 15:34620064-34620086 CATTGACAGCAGCTGGAGGGAGG - Intergenic
1125512982 15:40302764-40302786 CCATCCCAGCCGCTGGAGTCAGG - Intronic
1126694241 15:51312849-51312871 CCTCACAAGCAGCTGGAGGGAGG - Intronic
1128016946 15:64356085-64356107 CTTTCCCAGGAGCGGGAGGGAGG + Exonic
1128253372 15:66179419-66179441 CATTCCGCCCAGCTGGAGGTTGG + Intronic
1128375320 15:67070211-67070233 CCTCCCTAGCAGCTGGAAGGGGG - Intronic
1129532266 15:76277865-76277887 CCTCCACAGGAGCTGGTGGTGGG - Intronic
1130115469 15:81001594-81001616 GCTTCCCAAGAGCTGGAGGCAGG + Exonic
1130794499 15:87194562-87194584 CCTTCCCCGCAGCCAAAGGTAGG + Intergenic
1131061957 15:89409894-89409916 CATCCCCTGCACCTGGAGGTGGG - Intergenic
1131154214 15:90064990-90065012 ATTTCCCAGCAGCTGGACATTGG + Intronic
1131365339 15:91834390-91834412 ATTTCCCAGCAGCTAGAGGAAGG - Intergenic
1132223527 15:100123387-100123409 CCTTCCCAGGAGCTGAAGGTGGG + Intronic
1132533679 16:466812-466834 CCTTCCCAGCAGCTGACAGATGG + Intronic
1132585457 16:704259-704281 CCTTCTCATCAGTGGGAGGTAGG + Intronic
1132602883 16:781780-781802 CCTGCCCAGCAGCAGCAGGACGG - Intronic
1132726923 16:1342913-1342935 CCTCGCCAGCTGCTGGAGTTGGG - Exonic
1133129114 16:3665267-3665289 TCTCCCCAGCAGCAGGAGGAGGG - Exonic
1133267338 16:4593119-4593141 CCTTCCCAGCAGGAGGAAGGAGG - Intronic
1133756735 16:8767534-8767556 AGTCCCCAGCAGCTGGAGGTAGG + Intronic
1134015327 16:10884158-10884180 GCTTCTCAGCAGTTGGAGGCAGG - Intronic
1134841014 16:17401608-17401630 CCCTCCCAGCTCCTTGAGGTGGG - Intronic
1136224071 16:28846810-28846832 CCTCTGCCGCAGCTGGAGGTAGG + Exonic
1136289830 16:29264870-29264892 CCTTCCCAGCAGCATCAGGGAGG - Intergenic
1136471192 16:30481640-30481662 CATGCCCTGCAGCTGGAAGTGGG - Intronic
1136564456 16:31061636-31061658 CCTGCACAGGAGCTGGTGGTGGG - Exonic
1136609400 16:31357087-31357109 CCTTCCCAGCTGCTGGTGAGTGG + Exonic
1137239264 16:46640973-46640995 CCTTCCCAGCAGCCCCAGTTAGG + Intergenic
1137586420 16:49666677-49666699 CCTGCCTAACAGCTGGAGATGGG + Intronic
1138078389 16:54065276-54065298 CCTTCCCAGTAGCTGGGACTAGG + Intronic
1138242157 16:55435977-55435999 GCTTCCCAGGAGCTGGAGAAAGG - Intronic
1138840716 16:60501448-60501470 CCTTCCCAGCCTCTAGTGGTTGG + Intergenic
1139383315 16:66548331-66548353 CCTTCCCAGCCACTGGAGCTAGG + Intronic
1139710843 16:68774712-68774734 CCTGGGCAGCAGCTGGAGGGTGG + Intronic
1140164287 16:72533427-72533449 CCTCCCCAGTAGCTGTAGCTGGG + Intergenic
1140530589 16:75662430-75662452 CCTTCCCAGAAGTTGGAGGGTGG + Intronic
1140908824 16:79432828-79432850 CCTTCCCAGCTTCTGGTAGTTGG - Intergenic
1141461159 16:84179553-84179575 GCTGCCCAGCATCTGGCGGTGGG + Exonic
1142095714 16:88238346-88238368 CCTTCCCAGCAGCATCAGGGAGG - Intergenic
1142158177 16:88542469-88542491 CCTTCCCAGCAGATGGCAGGAGG - Intergenic
1142625608 17:1189982-1190004 CTTTTCCAGCTGGTGGAGGTGGG - Intronic
1144160573 17:12553696-12553718 CATCCCCAGAAGCTGGAGGAAGG - Intergenic
1144810321 17:17994639-17994661 TCTCTCCAGCAGCTGGAGGCAGG - Intronic
1144836442 17:18158908-18158930 CCATCCCTGCAGTGGGAGGTGGG - Exonic
1145089972 17:19978086-19978108 CCCTCCCAGCAGCTGGAACGGGG + Intronic
1145838353 17:27972056-27972078 TCTTGCCAGCAACTGGAGGGTGG + Intergenic
1147380485 17:40052711-40052733 CCTACTCAGAAGGTGGAGGTAGG - Intronic
1147421175 17:40322837-40322859 CCTTCCCTCCAGCTCCAGGTAGG + Intronic
1147437093 17:40423223-40423245 CTTTCCCAGCAGAAGGAGGCTGG + Intergenic
1147651229 17:42063017-42063039 CCTTCTCAGCCGGTGGGGGTGGG + Exonic
1148096912 17:45058758-45058780 CCTTCCCTGCAGCTGCAAATAGG + Intronic
1148982684 17:51592264-51592286 CCTTCCCCGCTTCTAGAGGTGGG - Intergenic
1149696588 17:58621151-58621173 CCATCACAGCTGCAGGAGGTGGG - Intronic
1150245593 17:63672415-63672437 CCTTCCCAGCACCTGGAACCAGG - Intronic
1151383292 17:73740145-73740167 CCCTCCCAGCAGCTGGTAGAAGG - Intergenic
1151479123 17:74360064-74360086 CAGTCCCAGCAGCAGGCGGTGGG + Exonic
1151654513 17:75489646-75489668 CCTTGCCTGGAGCTGGAGGAGGG - Exonic
1152190096 17:78883089-78883111 CCTCCACAGCAGCTGCAGGGCGG - Intronic
1152240880 17:79160367-79160389 TCTGCCCTGCAGCTTGAGGTGGG - Intronic
1152475616 17:80516210-80516232 CATTCCCCAGAGCTGGAGGTGGG + Intergenic
1152675353 17:81637203-81637225 CCATCCCTGCAACTGGAGGAGGG + Exonic
1152797819 17:82316614-82316636 CCTGGCCAGCAGCTGGGGTTGGG + Intronic
1153349837 18:4067167-4067189 CCTTACCTGAAGGTGGAGGTTGG + Intronic
1155174459 18:23290333-23290355 CCTTCCCCGCAGCTGGTTCTGGG - Intronic
1155663484 18:28279264-28279286 GGTTACCAGGAGCTGGAGGTTGG - Intergenic
1156779917 18:40838634-40838656 CCTTTCAAGCAGCAGGAGCTCGG - Intergenic
1158964510 18:62611297-62611319 CTTTCCCAGCTGCTGGAGCCGGG - Intergenic
1160107083 18:75988379-75988401 CCTTCCCAGTTTCTGGAGGATGG + Intergenic
1162556695 19:11391148-11391170 CATTCCCACCAGCAGGAGGGAGG + Intronic
1162557425 19:11396047-11396069 CCTCCCCAGTAGTTGGAGTTGGG + Intronic
1162569888 19:11465719-11465741 CCTTCTCAGCAGCTGCAGCTGGG - Intronic
1163132675 19:15285441-15285463 CCTCCCAAGTAGCTGGAGCTGGG - Intronic
1163313406 19:16527279-16527301 CCTGGCCAGCACTTGGAGGTGGG + Intronic
1163350021 19:16770674-16770696 TCTTCCCAGCAGCCCTAGGTGGG - Intronic
1164640545 19:29822161-29822183 CCTTCCCTGCAGCTGGAGTGAGG + Intronic
1164683207 19:30149718-30149740 CCTGCCCACCACCTGTAGGTAGG + Intergenic
1164952214 19:32345975-32345997 CTTGCCCTGCAGCTGGGGGTGGG + Intronic
1165738632 19:38192976-38192998 CCTTACCCGGAGCTGGAGGGTGG + Intronic
1165771390 19:38382428-38382450 ACCTGGCAGCAGCTGGAGGTGGG + Intronic
1166500463 19:43337448-43337470 CCTTCCCTGCCGCTCCAGGTGGG + Intergenic
1167492995 19:49802582-49802604 CTTACTCAGCAGCTGGAGCTGGG - Exonic
1167807637 19:51799693-51799715 GCTCCCCAGCAGCTGCAGGAGGG + Intronic
1168349364 19:55667285-55667307 CCTTCCCAGCATCAGGATGGAGG + Intronic
925689359 2:6505526-6505548 CCTACCCAGGAGCTGGAGCATGG + Intergenic
925902968 2:8521681-8521703 CCTTCCTTGCAGCAGGAGATGGG + Intergenic
926707889 2:15849501-15849523 CCTTCCTAGCAGCTGGGTGGGGG + Intergenic
927093047 2:19727110-19727132 CCTTTCCAGCATCTAGAGGCTGG - Intergenic
928143638 2:28752084-28752106 CCTTCCCAGCAGCGGGAACAAGG - Exonic
928144938 2:28764807-28764829 CCTACCCAGTAGATTGAGGTAGG + Intronic
929375246 2:41278787-41278809 CATTGCCAGCAGCTGGAGTTGGG - Intergenic
929666280 2:43836571-43836593 CGTTCTCAGCAGCTGGGGGATGG - Intronic
930022100 2:47007750-47007772 CATGCCCAGCAGATGGGGGTAGG - Intronic
930734523 2:54762898-54762920 CCTTTTCAGCAGATGGAGCTGGG + Intronic
931778215 2:65557752-65557774 CATTCTGAGCTGCTGGAGGTAGG + Intergenic
932068193 2:68589156-68589178 CCTTCCCAGGGACTGGAGGCAGG + Intronic
932138689 2:69255863-69255885 TATTCCCAGTAGCTGGGGGTGGG - Intergenic
932187852 2:69714194-69714216 CCCACCCAGCCACTGGAGGTGGG - Intronic
933362751 2:81308595-81308617 ACTTCACAGCAGCTGCAGATTGG - Intergenic
935102455 2:100009912-100009934 CTTTCCCAGCAGAAGCAGGTGGG + Intronic
935236015 2:101138852-101138874 CCTTCCCAGAGAATGGAGGTGGG + Intronic
935594422 2:104868007-104868029 CCTACCCACCAGCTGGAGGTCGG - Intergenic
935863212 2:107356928-107356950 CCTTCCCTGGAGCAGGAGGAAGG - Intergenic
936095515 2:109528071-109528093 GCATCCCAGCAGCTGAAGGGAGG + Intergenic
936471889 2:112806000-112806022 CCTTCCCCGGAGCTGTGGGTCGG + Intergenic
937290138 2:120776983-120777005 CCTCCCCAGCAGTGAGAGGTGGG + Intronic
937350477 2:121157185-121157207 CCTTCCAAGTAGCTGGAACTGGG - Intergenic
937414036 2:121700081-121700103 CCTGCCCAGCAGCTGATGCTAGG + Intergenic
938792173 2:134686279-134686301 CCTCCACAGCAGGTGGAGGAAGG + Intronic
940523080 2:154776356-154776378 ACTTCCTAGCAGATGGGGGTTGG - Intronic
942954844 2:181762114-181762136 CCTGCCCACCAACTGGAGGTTGG - Intergenic
943382551 2:187170216-187170238 CCATGGCAGCATCTGGAGGTGGG + Intergenic
946225485 2:218262048-218262070 CCTTCCTGGGAGCTGGAGGGAGG - Exonic
946288110 2:218720881-218720903 CCTTCCCAGAAGGTGGGGGATGG - Intronic
946997248 2:225408006-225408028 TCTTCACATCAGCAGGAGGTAGG + Intronic
948034698 2:234848534-234848556 CCTTCTCAGCAGCTGCAGCAGGG + Intergenic
948097997 2:235351466-235351488 CCCTCCCAGCCAGTGGAGGTTGG - Intergenic
948979686 2:241486833-241486855 CCTTCCCACCTGCAGGAGCTAGG + Intronic
1168777778 20:462353-462375 CCGTCCCAGTGGCCGGAGGTGGG + Exonic
1168996417 20:2136451-2136473 CCTTACCAGCTGCTGGAGTTTGG + Intronic
1169424433 20:5485235-5485257 CCTGCCCAGCAGCTGCAGGGAGG - Intergenic
1169427895 20:5510532-5510554 CCTGCCTAGCAGCTGCAGGGAGG + Intergenic
1169523953 20:6402747-6402769 TCTTCTCAGAAGCTGGAGGCTGG + Intergenic
1171191339 20:23161708-23161730 CCTTCCTAGCTGTTGGGGGTGGG + Intergenic
1172018968 20:31899304-31899326 CATTCCAAACAGCAGGAGGTAGG + Intronic
1172066790 20:32227077-32227099 TCTTCCCTCCAGCTGGAGGGGGG - Intronic
1172153535 20:32807815-32807837 CCTTCCCAGCAGCTTCTGGCGGG - Exonic
1172689011 20:36777835-36777857 TCTTCCCAGCTGCTGGGGGTTGG + Exonic
1173166739 20:40691182-40691204 CCCTGCCAGTAGCTGGGGGTTGG + Intergenic
1173235287 20:41239623-41239645 CCATCCCTGGAGCTGGGGGTGGG + Intronic
1173769291 20:45644462-45644484 CCCCCCAAGCAGCTGGAGCTGGG + Intergenic
1173828985 20:46066503-46066525 CCATCCCAAGAGCTAGAGGTGGG - Intronic
1174274042 20:49390649-49390671 CCTCCCCTGCAGCTGGATGGAGG + Intronic
1174513301 20:51072337-51072359 GGTTCCCAGAAGCTGGAGTTGGG + Intergenic
1175074737 20:56362969-56362991 CTCCCTCAGCAGCTGGAGGTGGG + Intronic
1175790025 20:61735234-61735256 TCTCCCCAGCAGCTGGAATTAGG + Intronic
1175899235 20:62353515-62353537 CCTTCCCTGCCGCAGGAGTTTGG + Intronic
1176083058 20:63283590-63283612 GCGTCCCTGCAGCTGGGGGTGGG - Intronic
1178045758 21:28692976-28692998 TTTTGCCAGCAGCTGGAGGAGGG + Intergenic
1178422965 21:32456824-32456846 CCTTCCCAGGACCTGGAGGAGGG + Intronic
1178431197 21:32520202-32520224 TCCTCTCAGCAGCTGGAGGCTGG - Intergenic
1178437574 21:32573469-32573491 CCGTCCCAGCAGGTGGGAGTGGG + Intergenic
1178448114 21:32663875-32663897 ACTTGCTAGCAGCTGAAGGTGGG + Intronic
1178800618 21:35791772-35791794 TCCTCCCAGCACCTGCAGGTGGG - Intronic
1179311004 21:40196262-40196284 CAGTCCCAGCGGCAGGAGGTTGG - Intronic
1179553033 21:42155396-42155418 TCTTCACAGCTGCTGGTGGTTGG + Intergenic
1180631332 22:17232253-17232275 CCCTCCCTGCTGCTGGAGGAAGG - Intergenic
1181304837 22:21909872-21909894 CCTTCCCCTCATCTGCAGGTGGG - Intergenic
1182283807 22:29232416-29232438 GGATCCCAGCAGGTGGAGGTGGG + Intronic
1182997548 22:34828069-34828091 CCTTGCCAGCACCTTGATGTTGG - Intergenic
1183358135 22:37370268-37370290 GGTTCCCAGCAGCAGGAGTTAGG - Exonic
1184532433 22:45064790-45064812 CCTTCCCACCACCTGGGGCTGGG + Intergenic
1184786159 22:46673004-46673026 CCATCCCCGCAGCTGGGGGCCGG - Intronic
1184847854 22:47100130-47100152 CCATCCCTGCAGCTGCAGGCCGG + Intronic
1185026613 22:48417736-48417758 TCACCCCGGCAGCTGGAGGTGGG + Intergenic
1185119693 22:48958581-48958603 CCTGCCCAGCAGCCAGAGGAGGG - Intergenic
1185154846 22:49187342-49187364 TGTTCCCAGGGGCTGGAGGTGGG + Intergenic
1185391650 22:50564670-50564692 CCTGCTCAGGAGCTGGAGGTGGG + Intergenic
1185392731 22:50571344-50571366 CCCTCTCAGCAGCGGGAGGCGGG + Intronic
949517541 3:4821040-4821062 CCCTCCCAGCAGCAGTGGGTAGG - Intronic
949598635 3:5574853-5574875 TGTCCCCAGCAGCTGGAGGATGG + Intergenic
951532422 3:23710190-23710212 GCTACCGAGCAGCTGGAGGTGGG - Intergenic
952790544 3:37197171-37197193 CATTCACAGCAGCTGGGGGATGG - Intergenic
953081700 3:39625722-39625744 CCTCCACAGCATCTGGAGCTTGG - Intergenic
953169403 3:40493764-40493786 CCTTCCCAGAGGTTGGAGGTTGG - Intergenic
953345510 3:42172149-42172171 CCCTCCTAGGAGCTGGAGGAGGG - Intronic
953532167 3:43748552-43748574 CCTGCGCAGCAGCTTGTGGTAGG + Intergenic
954363490 3:50134531-50134553 CCTTCCCACCAGCTGGCAGCAGG - Intergenic
959612620 3:108312460-108312482 CACTCACAGCAGCTGGAGTTTGG - Intronic
961343587 3:126246630-126246652 CATGCCCAGCCGCTGGAGATGGG + Intergenic
961435074 3:126911358-126911380 CCTTCCCAGGAGATGGAGTCTGG + Intronic
962836910 3:139197748-139197770 CCTTCCCACCAGCCTGAGGTGGG - Intronic
963110352 3:141683141-141683163 CCCTCCCAGGAGCTGGAGCCTGG - Intergenic
963785978 3:149534829-149534851 CTTTCCTAGCAGCTGGAGGACGG + Intronic
964718732 3:159750654-159750676 CACTCACAGCAGCTGGGGGTAGG + Intronic
964863877 3:161232073-161232095 CCATTCCTGCAGGTGGAGGTTGG + Intronic
966103274 3:176302526-176302548 GCTTGCCAGGAGCTGGAGGGAGG - Intergenic
966793539 3:183694225-183694247 CCTGCACAGCCACTGGAGGTGGG - Intergenic
967085983 3:186095834-186095856 CTTCCCCACCAGCTGGAGGCTGG + Intronic
967891097 3:194365150-194365172 CCTTCCCAGGAGCTGGACAGGGG - Intronic
967902857 3:194474408-194474430 CCTTCCAAGCAGCTGGAAATAGG + Intronic
968712173 4:2127050-2127072 GCTGCCCAGCACCTGGGGGTGGG - Intronic
969300691 4:6295258-6295280 CCTTCCAGGAAGCTGCAGGTGGG + Intronic
969685587 4:8672289-8672311 CATTCCCAGCAGCTAGGGATGGG + Intergenic
969714355 4:8861176-8861198 GCTTCCCAGCAGGTAGAGGAGGG - Intronic
970549683 4:17166827-17166849 CAAGCCCTGCAGCTGGAGGTTGG + Intergenic
970925900 4:21452050-21452072 CCTTCCCAGCTTCTGGAAGGCGG - Intronic
971171777 4:24241027-24241049 CCATTCCTACAGCTGGAGGTGGG - Intergenic
971569593 4:28193994-28194016 CCTTGCCAGCACCTTGATGTGGG + Intergenic
972340259 4:38146537-38146559 CTTCCCCAGGAGCTGGAGGAGGG - Intergenic
973615140 4:52670654-52670676 CCCTCCCACCAGGTGGTGGTGGG - Intergenic
974051417 4:56945618-56945640 GCTTCTCAGGAGGTGGAGGTGGG - Intergenic
975150037 4:71011056-71011078 CCTTCCAAGTAGCTGGAGCTGGG + Intronic
975377477 4:73662667-73662689 CCTTCCCCTGAGCTGGAAGTGGG + Intergenic
975505725 4:75134569-75134591 CCTACTCAGGAGCCGGAGGTGGG + Intergenic
977097120 4:92760344-92760366 TCTTCCCAGCAGCCAGAGGAAGG - Intronic
977235799 4:94505944-94505966 CCTTCCTAGAGGTTGGAGGTGGG + Intronic
977378357 4:96237630-96237652 CCTTCACAGGACCTGGAGGATGG - Intergenic
978328943 4:107590324-107590346 CCGTCCCAGCAGCCACAGGTGGG - Intronic
978373700 4:108053445-108053467 GATTCCCAGAAGCTGGAGGTGGG + Intronic
979252551 4:118580578-118580600 CTTTCCCAACAGCTGGATGAGGG + Intergenic
980722506 4:136716820-136716842 CCCTCCGAGCAACAGGAGGTGGG - Intergenic
980883246 4:138735008-138735030 CATCACCAGCAGCTGGAGTTGGG + Intergenic
982240892 4:153298354-153298376 CCCTCCCAGCACCTGGATTTTGG - Intronic
982452599 4:155570784-155570806 CCTTCACTGTGGCTGGAGGTGGG + Intergenic
983184218 4:164682524-164682546 CATTGCCAGTAGCTGGAGCTAGG - Intergenic
984130155 4:175864925-175864947 CCTCCCCAGCAGCTGCAGCTGGG + Intronic
984148988 4:176102340-176102362 CCTTGCCAGCATCTGGTGTTTGG - Intronic
985566348 5:620244-620266 CCTACCCAGCTGCTGGAGCTTGG - Exonic
985725547 5:1514118-1514140 TCTCCCCAGCCGCTGGTGGTGGG - Intronic
985779409 5:1862242-1862264 CCCTCTCAGCTGCTGGAGGGTGG - Intergenic
985914327 5:2906145-2906167 GCCTCTCAGCAGTTGGAGGTAGG - Intergenic
986195581 5:5534223-5534245 CCTGCCCTGGAGCTGTAGGTGGG - Intergenic
986237996 5:5929918-5929940 CCTTCCCAGCCCCTGGAAGCTGG - Intergenic
986325502 5:6670279-6670301 GCTTCCCTGCAGCTTGAGGCAGG - Intergenic
987359298 5:17092346-17092368 TCATCCCAGAAGCTGGAGCTGGG + Intronic
989666441 5:43859667-43859689 CCTTCCCAGGGGTTGGGGGTTGG - Intergenic
990173805 5:53084684-53084706 CCTTCCCAGCTGCTGCAGTGTGG + Intronic
990770390 5:59237280-59237302 CCTTCCCAGCTATTTGAGGTTGG + Intronic
991292264 5:65044612-65044634 GCTTCCCCACAGCTGCAGGTGGG + Intergenic
992325851 5:75658945-75658967 GGTTCCCAGGAGCTGGAGGAGGG - Intronic
992854674 5:80848115-80848137 GCTTCCCAGCAGGCTGAGGTGGG + Intronic
993010000 5:82470186-82470208 CCTTCCCAGAAGCTGTAGTCTGG + Intergenic
993270077 5:85785576-85785598 CCTTCCCACAACTTGGAGGTAGG + Intergenic
993654643 5:90562554-90562576 CCTGCCCAGCAGCTCGGGGAGGG - Intronic
994003804 5:94814015-94814037 GGTTTCCAGGAGCTGGAGGTGGG + Intronic
995783411 5:115802247-115802269 TCTTACCTGCAGCTGGAGCTTGG - Intergenic
996092433 5:119364053-119364075 CCCTCCCAGCACCTCCAGGTGGG + Intronic
997387761 5:133487049-133487071 CCTTGCCAGCAGCTGTATCTGGG + Intronic
998146819 5:139733861-139733883 CCAGCCCAGGAGCTGGGGGTAGG + Intergenic
999160032 5:149487898-149487920 CCTTCCAAGTAGCTGTAGCTGGG - Intergenic
999934836 5:156475378-156475400 CCTTCCAAGCTGCTGGTGTTGGG + Intronic
1001746667 5:174098000-174098022 CCTTCCCAGCAGAAGGTGGCTGG + Intronic
1002025285 5:176392634-176392656 CCCTCCCAGCGCCTGGAGATGGG + Exonic
1002998723 6:2311274-2311296 ACTTCCTAGCAGCTGAAGGAGGG - Intergenic
1003126684 6:3361465-3361487 CTTTCCCAGCAGCTGAACTTTGG - Intronic
1003797803 6:9624697-9624719 GATTTCCAGCAGGTGGAGGTTGG - Intronic
1004439233 6:15631735-15631757 CCTCCCCAGCCCCTGCAGGTTGG + Intronic
1004460228 6:15828420-15828442 CCTTCTCAGAATCTGGAGTTGGG + Intergenic
1005268760 6:24140912-24140934 CCTTTCCAGCAGCAGGAACTGGG + Intronic
1006022260 6:31124224-31124246 GCTACCCAGGAGGTGGAGGTGGG + Intronic
1006140248 6:31924457-31924479 CCTTCCCACCAGCTGGAATGTGG - Intronic
1006473398 6:34240567-34240589 CCTTGGCAGCATCTGGGGGTGGG + Intronic
1006597240 6:35202438-35202460 CCTCCCCACCAACTTGAGGTTGG + Intergenic
1006630731 6:35427909-35427931 CCTACCCAGCTGATGGGGGTTGG + Exonic
1006656088 6:35594240-35594262 GCTACCCAGGAGCTTGAGGTGGG + Intronic
1007179231 6:39916210-39916232 CCCTTCCAGCCGCTGGAGCTGGG + Exonic
1007284185 6:40736063-40736085 ACCTCCCACCAGCTGGAGATTGG + Intergenic
1007411452 6:41664473-41664495 CTTTCCCTGCAGCTGGATGCTGG - Intergenic
1007593592 6:43038082-43038104 CTGTCCTAGCAGCTGGTGGTTGG - Intronic
1007607440 6:43127093-43127115 CCTTCCAAGTCCCTGGAGGTGGG - Intronic
1007937921 6:45750387-45750409 CCTTCCCAGAGGCTGGTGGGTGG - Intergenic
1008091305 6:47296565-47296587 CCTTCCCTGAGGTTGGAGGTGGG - Intronic
1010730254 6:79383088-79383110 TATTCCCAGCAGCTGGGGGATGG + Intergenic
1011502522 6:88006846-88006868 CCATCCCGGCAGCAGGAGGAAGG + Intergenic
1013117436 6:107114344-107114366 GCTGCCCAGGAGCTGGAGGCGGG - Exonic
1015366346 6:132401453-132401475 ACTCCCCAGCGGCTGGAGGCCGG - Exonic
1016059445 6:139614465-139614487 CTTTGCCAGCAGCTTTAGGTTGG + Intergenic
1016934294 6:149437353-149437375 CATTCCCACCAGCAGGATGTGGG + Intergenic
1017137560 6:151161652-151161674 CCAGGCCAGCAGCGGGAGGTGGG + Intergenic
1018160877 6:161041281-161041303 CCTTCCCAGCACCTGTCTGTGGG + Intronic
1018354963 6:163003656-163003678 GCTTATCAACAGCTGGAGGTAGG + Intronic
1018638346 6:165884404-165884426 CCTGGACAGCAGCTGGAGGAAGG + Intronic
1018796208 6:167187259-167187281 CCATCCCAGCAGGTGGGAGTGGG - Intronic
1018820110 6:167367798-167367820 CCGTCCCAGCAGGTGGGAGTGGG + Intronic
1018857092 6:167682434-167682456 CCTTCCCAGCAGCTCTCGGTGGG - Intergenic
1019294935 7:269063-269085 CCTTCCTGGCTGCTGGAGGACGG + Intergenic
1019403220 7:868319-868341 TCTGCCCTGCACCTGGAGGTGGG + Intronic
1019415684 7:925622-925644 CCTGCCCAGGAGCTGCTGGTGGG - Intronic
1019707905 7:2505130-2505152 CCTGCCCAGCAGATGCGGGTTGG - Intergenic
1019730729 7:2627945-2627967 CCTTCCTGGCAGCTGGAGGGAGG + Intergenic
1019769302 7:2873496-2873518 CCTTCCCTGCACCTCGAGTTTGG + Intergenic
1019775575 7:2910201-2910223 CCTTCACAGGAGCGGGAGGTGGG - Intronic
1020001250 7:4757206-4757228 CTTTCCTAACAGCTGGAGGACGG - Intronic
1020800499 7:12726810-12726832 CCTTCCCAATAGGTGGAGGGAGG - Intergenic
1022445840 7:30469971-30469993 CCTTCCCAGCAGGGAGAGATGGG - Intronic
1023057253 7:36300199-36300221 CCCTCCTAGTGGCTGGAGGTAGG + Exonic
1023768827 7:43536438-43536460 ACCTCCCAGCAGCGGGTGGTGGG - Intronic
1024243571 7:47453386-47453408 CCCTCCCAGCAGCTCGAAGTAGG - Intronic
1024570602 7:50719965-50719987 CGCTCCCAGCAGCTGGAGTGGGG - Intronic
1025270535 7:57508723-57508745 CCTCCCCAGAAGCTGGAGTGTGG + Intergenic
1026714456 7:72775404-72775426 TCTTCCAAGTAGCAGGAGGTTGG + Intronic
1027360927 7:77408909-77408931 CCTGCACTGGAGCTGGAGGTGGG + Intronic
1029220781 7:98988588-98988610 GGTTCCCAGGGGCTGGAGGTGGG + Intronic
1029526993 7:101100750-101100772 CCTTCCCTGCTTCTGGGGGTTGG + Intergenic
1030004869 7:105107722-105107744 CCCTCGCATCAGTTGGAGGTTGG + Exonic
1031206929 7:118771847-118771869 ACTAGCCAGCAGCTGGAGGATGG - Intergenic
1032173803 7:129607881-129607903 CCTTCCCCCAAGGTGGAGGTAGG - Intergenic
1034380064 7:150684131-150684153 CACTCCCAGCAACTGGAGATAGG - Intergenic
1034448729 7:151126325-151126347 CCTTCCAGGCCGCTGGAGATGGG + Intronic
1035122922 7:156583654-156583676 CTTACCCTGCAGCTAGAGGTGGG - Intergenic
1035550121 8:516598-516620 CCTTGCCAGCATCTGGTGGTGGG - Intronic
1035782486 8:2239508-2239530 ACCTACCACCAGCTGGAGGTTGG - Intergenic
1035809633 8:2480080-2480102 ACCTACCACCAGCTGGAGGTTGG + Intergenic
1036692032 8:10950151-10950173 GCTTCCCAACAGGTGGGGGTGGG + Intronic
1037945553 8:22987429-22987451 CCTTCCCATAAGCTGGACTTTGG + Exonic
1040068502 8:43169388-43169410 CCTTCCCAGCAGCTGAAGAGAGG - Intronic
1041795859 8:61747239-61747261 CCTTCTCTGCAGCTGCAGGTAGG - Intergenic
1042468103 8:69151811-69151833 TATTCCCAGAAGCTGGAGGATGG + Intergenic
1043204556 8:77420626-77420648 CATTCCTAGCAGCTGGAGGATGG + Intergenic
1043281723 8:78476219-78476241 TCTTCTCAGGATCTGGAGGTTGG + Intergenic
1043428735 8:80173859-80173881 ACTGCCTTGCAGCTGGAGGTGGG + Intronic
1043880713 8:85539396-85539418 CCATCCCAGCAAGAGGAGGTGGG - Intergenic
1046932491 8:119855620-119855642 CTGTGCCAGCAGCTGGAGGATGG - Exonic
1047223577 8:122938344-122938366 CCTTCCCAGCTGCAGGTGGCTGG - Intronic
1047402076 8:124556273-124556295 CCTCCTCAGCTGCTGCAGGTGGG + Exonic
1049107934 8:140625215-140625237 GCTACCCAGGAGGTGGAGGTTGG - Intronic
1049138285 8:140926383-140926405 CCTTTGTAGCATCTGGAGGTAGG - Intronic
1049511302 8:143028154-143028176 CCTCCCCTGCAGGTTGAGGTTGG - Intergenic
1049534441 8:143171723-143171745 CCCTCCGAGCTGCTGGAGGTGGG + Intergenic
1049546029 8:143231365-143231387 CACTCCCAGCAGCAGCAGGTAGG - Intergenic
1052346474 9:27414750-27414772 CCTTCCAAGCAGCTGCTTGTAGG + Intronic
1052941335 9:34133793-34133815 CCTGCCAATCACCTGGAGGTGGG + Intergenic
1053117124 9:35514847-35514869 CCTTCCTAGCAGCAGGATGGAGG + Intronic
1055739981 9:79377487-79377509 CCTGCCCTGCAGCTGGGGGAGGG - Intergenic
1056534182 9:87513566-87513588 CTAGACCAGCAGCTGGAGGTAGG + Intronic
1056595936 9:88007563-88007585 CCTTCCCAGCAGGAGGGGCTGGG - Intergenic
1056742316 9:89268226-89268248 GGTTGCCAGAAGCTGGAGGTGGG - Intergenic
1056879833 9:90380529-90380551 CTGTCCCATCAGCTGGGGGTGGG - Intergenic
1057162149 9:92896338-92896360 CCTTCCCTACAGATGGAGGCAGG + Intergenic
1057195358 9:93113375-93113397 CTGTGCCAGCAGCTGGATGTGGG - Intergenic
1058741394 9:107946289-107946311 ACTTCCAAGAAACTGGAGGTGGG - Intergenic
1059552634 9:115244836-115244858 GCTTTCCAGCAGATGGAGATGGG + Intronic
1060846047 9:126838573-126838595 CCTTCCCGCCAGCTGTGGGTTGG + Intergenic
1060882992 9:127131672-127131694 GCTTCCCAGCAGTGTGAGGTTGG + Intronic
1061054423 9:128214875-128214897 CCTAACCAGGAGCTGGAGGCTGG + Intronic
1061087194 9:128405983-128406005 CCTTCTCAGCAGCAGGAGCTGGG + Intergenic
1061196607 9:129110359-129110381 CCACCCCATCAGCTGGAGGCCGG + Intronic
1061798635 9:133102632-133102654 CCTGCCCAGAAGCTGGAGTCGGG + Intronic
1062209606 9:135356571-135356593 CCTTCCCAGCAGCGGGGTGGAGG + Intergenic
1062261723 9:135666247-135666269 CCTTCCCGGGAGCTGGTGGAGGG - Intronic
1062581951 9:137232683-137232705 ACTGCCCAGCAGCTGGAAGGCGG - Exonic
1186222312 X:7363151-7363173 CTTTGCCAGAAGCTGGAGGGAGG + Intergenic
1186256870 X:7731261-7731283 CCTCCCTAGCAGCTGGAACTAGG + Intergenic
1186406795 X:9311619-9311641 TCCTCTCTGCAGCTGGAGGTGGG - Intergenic
1186623712 X:11269007-11269029 CCTTTCATTCAGCTGGAGGTAGG - Intronic
1187120314 X:16399362-16399384 CCTCCCGAGTAGCTGGAGCTGGG + Intergenic
1187507521 X:19888664-19888686 CCTTTCCACCATCTGGTGGTAGG + Intergenic
1188560387 X:31461842-31461864 CCATCACAGCAGCTGAAGGATGG - Intronic
1188669328 X:32863844-32863866 ACTTCCCAGTAGGTGGAGGATGG - Intronic
1189044954 X:37580717-37580739 AATTGCCAGAAGCTGGAGGTGGG - Intronic
1189251714 X:39605406-39605428 CATTTCCAGCAGCTGCAGGAGGG + Intergenic
1189361966 X:40359822-40359844 CCTCCCAATCACCTGGAGGTGGG + Intergenic
1189954102 X:46260800-46260822 CCTGCCCAGCAGCAGGGGATAGG + Intergenic
1190023825 X:46903937-46903959 CCGACCCAGCAGCAGCAGGTAGG + Intergenic
1190839430 X:54130646-54130668 CCTCCCCAGCAGGAGCAGGTAGG + Intronic
1190877381 X:54469779-54469801 ACTTCTCAACAGCTGGAGGAGGG - Intronic
1192350806 X:70354894-70354916 TCTTCCCAGCTGCTGGGGGTTGG + Intronic
1192600614 X:72459713-72459735 CCTCCCTAGCTGCTTGAGGTAGG + Intronic
1195706561 X:107741906-107741928 CCCGCCCAACAGCTGGAGATGGG - Intronic
1198567143 X:137916364-137916386 CCTACCCAGCAGGTGGTGGCAGG + Intergenic
1199134688 X:144236024-144236046 TCTTCCCAGGAGCATGAGGTTGG - Intergenic
1200038762 X:153350556-153350578 ACTTCCCAGCAGCTGTGGCTGGG + Exonic
1202273161 Y:23089564-23089586 CTTTCTCAGCTGCTGCAGGTTGG - Intergenic
1202292865 Y:23331118-23331140 CTTTCTCAGCTGCTGCAGGTTGG + Intergenic
1202426158 Y:24723308-24723330 CTTTCTCAGCTGCTGCAGGTTGG - Intergenic
1202444631 Y:24946778-24946800 CTTTCTCAGCTGCTGCAGGTTGG + Intergenic