ID: 902820129

View in Genome Browser
Species Human (GRCh38)
Location 1:18938593-18938615
Sequence AAGTCAGCACAGGCAGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 393
Summary {0: 1, 1: 0, 2: 0, 3: 42, 4: 350}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902820129_902820139 29 Left 902820129 1:18938593-18938615 CCCAGCTCTGCCTGTGCTGACTT 0: 1
1: 0
2: 0
3: 42
4: 350
Right 902820139 1:18938645-18938667 CTCTCTAGACCTTCTGCACAAGG 0: 1
1: 0
2: 0
3: 16
4: 183

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902820129 Original CRISPR AAGTCAGCACAGGCAGAGCT GGG (reversed) Intronic
900001251 1:15983-16005 AAGGCTGCTCAGGCAGGGCTGGG + Intergenic
900020967 1:186505-186527 AAGGCTGCTCAGGCAGGGCTGGG + Intergenic
900472463 1:2861573-2861595 AAGTCAGCACCGCCAGAGCCGGG + Intergenic
900484107 1:2913382-2913404 ACCTCAGCACAGGCAGCACTCGG - Intergenic
902605642 1:17567774-17567796 TAGTCAGCACAGGGCCAGCTTGG - Intronic
902820129 1:18938593-18938615 AAGTCAGCACAGGCAGAGCTGGG - Intronic
903360684 1:22775216-22775238 AAGTGCACACAGGCAGGGCTAGG - Intronic
904362486 1:29985663-29985685 AAGTCATTACAGAAAGAGCTAGG + Intergenic
904403548 1:30272416-30272438 ACCTCAGCACAGTCAGGGCTGGG - Intergenic
905225895 1:36479049-36479071 AAAGAAGCCCAGGCAGAGCTTGG - Intronic
905272461 1:36795943-36795965 AAGTCGGCCCAGGCAGAGGTGGG + Exonic
906933387 1:50190770-50190792 AGTTCTGCACAGCCAGAGCTAGG - Intronic
907281518 1:53350100-53350122 CAGTCAGCACAGTCAGGGATTGG - Intergenic
907733534 1:57090042-57090064 AAGTGAGCAGAGGCAAAACTTGG + Intronic
907733650 1:57091060-57091082 AAGTAAGCAGAGGCAAAACTTGG - Intronic
908106270 1:60845928-60845950 AAGTCAGAACATGCAGTGTTTGG - Intergenic
911588023 1:99713754-99713776 ATGTCAGCTCAGTCAGAGCTGGG - Intronic
912659683 1:111516373-111516395 AAATCAGCAGAGGCCGGGCTTGG + Intronic
915318013 1:155040630-155040652 GAATCTGCACAGGCAGAGCCTGG + Intronic
915939646 1:160110748-160110770 AATGCAGCACAGGCAGAGGCTGG + Intergenic
918004018 1:180524989-180525011 AAGACATCGCAGGCAGAGCAAGG + Intergenic
918045576 1:180939091-180939113 CCTTCAGCTCAGGCAGAGCTGGG + Intronic
919173315 1:193986502-193986524 AGGTCAGCACATGCAGAATTTGG + Intergenic
921299720 1:213739095-213739117 ATCTCAGCAGAGGCAGAGGTGGG - Intergenic
921415983 1:214887300-214887322 AAGTGAGAACATGCAGTGCTTGG + Intergenic
922228271 1:223664554-223664576 AAAACAACACAGGCAGAGCTAGG + Intronic
1063098092 10:2925961-2925983 AGGTCATCAGAGGCAGAGCCAGG - Intergenic
1063504388 10:6582632-6582654 AAGTCATCACAGGCTGGGCATGG - Intergenic
1063711166 10:8480112-8480134 AAGTGAGAACATGCAGTGCTTGG + Intergenic
1067574857 10:47402757-47402779 AGGTTAGCTCAGGCAGGGCTGGG + Intergenic
1067687493 10:48475952-48475974 ATAACAGCACAGGCAGAGGTAGG - Intronic
1067698472 10:48552266-48552288 AGGCCAGCACAGGCATAGCCTGG + Intronic
1069143399 10:64857867-64857889 AAGTCAGCACTGTTAGAGATGGG + Intergenic
1069789191 10:71008801-71008823 AAGTGGCCAGAGGCAGAGCTAGG + Intergenic
1069844509 10:71361884-71361906 GAGTCAGCACAGCCAGGGGTGGG - Intronic
1070746865 10:78939040-78939062 AAGACCACACAGGCAGAGCCCGG - Intergenic
1071030175 10:81169503-81169525 AAATCAGCAAAGGCAAAGGTTGG - Intergenic
1071455834 10:85850858-85850880 AACTCAGGAGAGGCAGAGCCAGG + Intronic
1072410328 10:95196019-95196041 AAAGCAGCACAGGCTGGGCTGGG - Intronic
1075622776 10:123939929-123939951 CTGTCCACACAGGCAGAGCTGGG + Intronic
1076453919 10:130576157-130576179 AAGTGAGGACAAGGAGAGCTGGG - Intergenic
1076457516 10:130611032-130611054 ACGTCAGCAAAGGTGGAGCTGGG - Intergenic
1076810795 10:132885486-132885508 AATTCAACACAGGGAGAGCGGGG - Intronic
1077039774 11:514845-514867 AAGTTAGCACAGGCGGGCCTGGG - Intergenic
1078141070 11:8693455-8693477 CAGAGAGCACTGGCAGAGCTGGG + Exonic
1078447286 11:11413795-11413817 AGGTCAGGACAGGCTGAGCCTGG - Intronic
1078448399 11:11422192-11422214 AAGTCATTACAGTAAGAGCTTGG + Intronic
1078746859 11:14124014-14124036 AAGTGAGCATATGCAGATCTGGG + Intronic
1079713963 11:23720905-23720927 AAGTCAGCACAGGCTCTGTTGGG - Intergenic
1079826481 11:25201518-25201540 AAATCAGCAGAGACAGGGCTAGG + Intergenic
1080593119 11:33740794-33740816 AAGACAGTACAGTCAAAGCTAGG + Intergenic
1081191722 11:40112122-40112144 GAGTCAGCAAAGACAGAGTTTGG + Intergenic
1081366396 11:42240478-42240500 GAGTCAGCTCATGCTGAGCTAGG - Intergenic
1081607397 11:44535978-44536000 TAGTGAGGACAGGCAGAGATGGG + Intergenic
1081664948 11:44911283-44911305 AAGCCAGCACCAGCAGTGCTGGG + Intronic
1081702681 11:45161918-45161940 AGGTCACCACCGGCAGGGCTGGG + Intronic
1082010593 11:47447621-47447643 AAGCCAGCAAGGGCAGAGCCAGG - Intronic
1082084143 11:48035230-48035252 AGGCCAGCAGAGTCAGAGCTTGG + Intronic
1082085342 11:48045277-48045299 AAGCGAGCAGAGGCAGAGTTGGG + Intronic
1083454530 11:62769846-62769868 AAGTCAGCTTAGCCAGACCTGGG - Intergenic
1084039089 11:66531210-66531232 AAAGCAGCAGAGGCAGGGCTTGG - Intronic
1084090318 11:66875379-66875401 AAGACAGAAAAGGCAGGGCTGGG + Intronic
1084435652 11:69137776-69137798 AAGACAGGGCAGGCAGGGCTGGG + Intergenic
1084646253 11:70460344-70460366 AGGTGTCCACAGGCAGAGCTTGG + Intergenic
1084782874 11:71422606-71422628 AAGTGAGAACATGCAGTGCTTGG - Intergenic
1087158405 11:94926344-94926366 CAGGCACCACATGCAGAGCTGGG + Intergenic
1089359751 11:117877826-117877848 AGGGCAGCAGAGGCAGGGCTAGG - Intergenic
1090457594 11:126863287-126863309 AAGACAGCACAGGCCAAGCTGGG + Intronic
1090793433 11:130112641-130112663 AACTGACCACAGGCTGAGCTAGG - Intronic
1091374342 12:16101-16123 AAGGCTGCTCAGGCAGGGCTGGG + Intergenic
1091400643 12:178698-178720 GGGTGAGCACTGGCAGAGCTGGG + Intergenic
1091619568 12:2076126-2076148 AAGTCAGGAAAGGCAGATCCAGG - Intronic
1092556225 12:9564991-9565013 AATTCAGCACAAACAGAGGTCGG + Intergenic
1094515867 12:31125661-31125683 AATTCAGCACAAACAGAGGTCGG - Intergenic
1094646410 12:32328826-32328848 AAGGCAGCTCAGGCGGTGCTGGG + Intronic
1095276123 12:40284758-40284780 AAGTTAACACAGGGAAAGCTGGG - Intronic
1095476210 12:42589646-42589668 AAGTCAGCGCAGGCTGCGCGAGG + Exonic
1096011887 12:48224820-48224842 AAGTGAGAACAGGCAGTGTTTGG - Intergenic
1096216188 12:49798638-49798660 ACCACAGCACAGGCAGATCTAGG + Intronic
1096578088 12:52567111-52567133 AGGTCAACACCCGCAGAGCTGGG + Exonic
1096814263 12:54191758-54191780 AAGTGAGCAGAGTCGGAGCTAGG - Intergenic
1097945824 12:65366455-65366477 AAAACAGCACAGGCAGAGGAAGG + Intronic
1097963564 12:65555955-65555977 AATTCAGCACAGGAAGGGCCAGG + Intergenic
1098245316 12:68511372-68511394 GAGTTAACACACGCAGAGCTGGG + Intergenic
1099730967 12:86501577-86501599 AAGTGAGAACATGCAGTGCTTGG + Intronic
1100704817 12:97188893-97188915 AAGTGAGAACATGCAGTGCTTGG - Intergenic
1101735202 12:107458334-107458356 CAGTAAGCAAAGGCAGACCTGGG + Intronic
1102346916 12:112166563-112166585 AAGTCAGAGCAGGCAGCCCTGGG + Intronic
1102400731 12:112627610-112627632 ATGTCAGCACTGGAAGAGCAGGG - Intronic
1103614565 12:122143817-122143839 AAGTCAGCAGAGGGAGAGGTAGG - Exonic
1103719073 12:122963916-122963938 TGGGCAGCACAGGCAGGGCTGGG - Intronic
1106697916 13:32197949-32197971 TATTCAGCATAGGCAGAGCAAGG - Intronic
1107049743 13:36034433-36034455 AGATCATCACAGGGAGAGCTGGG - Intronic
1107781503 13:43908294-43908316 AAGTCAGGAATGGTAGAGCTGGG + Intergenic
1109171223 13:59099379-59099401 AAGTCAGCAAATGTAGAACTTGG + Intergenic
1110868494 13:80423494-80423516 AAGTCAGAACATGCAGTGTTTGG + Intergenic
1112089302 13:96065759-96065781 ATGTCAGGACAGGGAGAGCAGGG - Intergenic
1112166549 13:96926466-96926488 AGGTAACCACAGGCAGAGCCTGG + Intergenic
1112457103 13:99573026-99573048 AAATCAGCACCGGCAGAACTTGG + Intergenic
1113305981 13:109079161-109079183 AAGTCAGCTGGGGCAGAGTTAGG + Intronic
1113766525 13:112884349-112884371 ATCTCCACACAGGCAGAGCTGGG - Exonic
1114845411 14:26314808-26314830 AAGTGAGAACATGCAGTGCTTGG - Intergenic
1116478961 14:45374485-45374507 AAGTGTACAGAGGCAGAGCTGGG - Intergenic
1117890261 14:60413577-60413599 AAGTGAGAACATGCAGTGCTTGG + Intronic
1118603290 14:67485573-67485595 AAGGCATGGCAGGCAGAGCTGGG - Intronic
1119860270 14:77931125-77931147 AAGTCAGGTCAGCCTGAGCTAGG + Intronic
1121650070 14:95551696-95551718 AACTCAACACAGGAAGAGCAAGG - Intergenic
1122357530 14:101132542-101132564 GAGCCATCACAGGCACAGCTAGG - Intergenic
1124143189 15:27095799-27095821 AAGTCAGAAGAGGCAGAGCCAGG - Intronic
1124224369 15:27879089-27879111 AAATGAGAACATGCAGAGCTTGG + Intronic
1125002382 15:34785011-34785033 AACTCATCAGTGGCAGAGCTAGG + Intergenic
1128556677 15:68636477-68636499 AAGTGGGAACAGGCAGGGCTGGG - Intronic
1129138022 15:73571637-73571659 AAGAGTGCACAGGCAGAGGTCGG + Intronic
1129519206 15:76175509-76175531 AATTCAGCAGTGGCAGGGCTTGG - Intronic
1130172283 15:81527883-81527905 AAGTGAGAACATGCAGTGCTCGG - Intergenic
1130870989 15:87972174-87972196 AGGTCTCCAAAGGCAGAGCTAGG + Intronic
1131404935 15:92156471-92156493 TGGTCAGGAAAGGCAGAGCTAGG - Intronic
1132452257 15:101974955-101974977 AAGGCTGCTCAGGCAGGGCTGGG - Intergenic
1132454639 16:15669-15691 AAGGCTGCTCAGGCAGGGCTGGG + Intronic
1132552079 16:557679-557701 AAGGCAGCGGAGGCAGCGCTCGG - Intergenic
1132593298 16:735941-735963 AAGTCAGCAGAAGCTGACCTTGG + Intronic
1132973545 16:2700621-2700643 AACTCAGGACAGGGAGGGCTGGG - Intronic
1134054633 16:11162002-11162024 AAGTCAGTTTGGGCAGAGCTTGG + Intronic
1134463022 16:14446227-14446249 GATTCAGCTCAGGCAGACCTGGG + Intronic
1134511910 16:14855210-14855232 AGGTGAGAACTGGCAGAGCTTGG + Intronic
1134699552 16:16253709-16253731 AGGTGAGAACTGGCAGAGCTTGG + Intronic
1134904981 16:17972370-17972392 AAGTGAGCAGAGGCAGAGATGGG - Intergenic
1134972276 16:18540962-18540984 AGGTGAGAACTGGCAGAGCTTGG - Intronic
1135035835 16:19076041-19076063 CATACAGCACAGACAGAGCTGGG + Intronic
1135064509 16:19298258-19298280 AAGTATGTACAGGCAGGGCTCGG + Intronic
1135245718 16:20855314-20855336 AATTAAGCACAGACGGAGCTGGG + Exonic
1136117003 16:28100966-28100988 AACTCAGCCCAAGCTGAGCTGGG + Intronic
1136226768 16:28865144-28865166 AAAACATCACAGGGAGAGCTGGG - Intronic
1136532704 16:30880407-30880429 AAGTCAGAACAGGCTGGGCGCGG + Intronic
1137070554 16:35900969-35900991 AAGTGACCACTGGTAGAGCTTGG + Intergenic
1137422832 16:48350695-48350717 AATTCAGGAGAGGCTGAGCTGGG + Intronic
1138534694 16:57653651-57653673 AGGTTGGCACAGGCGGAGCTGGG + Intronic
1139067857 16:63340947-63340969 AAGTGAGCACTGGAAAAGCTAGG - Intergenic
1139923306 16:70472776-70472798 AAGTCAGCACAGCCAGAGACTGG - Intronic
1139925715 16:70485077-70485099 AAGTCAGGAAAGGCTGAGCATGG + Intronic
1140337016 16:74117372-74117394 AAGTCAGAACATGCAGTGTTTGG - Intergenic
1140668400 16:77249472-77249494 AAGTCAACACAGGAAGGGCGCGG - Intronic
1141909705 16:87050347-87050369 AAGTCAGCACGGACATAGCTGGG - Intergenic
1142107938 16:88316208-88316230 AAGTCAGAACCCGCAGGGCTGGG + Intergenic
1142720648 17:1773567-1773589 CAGCTAGTACAGGCAGAGCTGGG - Intronic
1143921168 17:10332078-10332100 AGGTGAGCACAGGCAAGGCTGGG - Exonic
1144135999 17:12295586-12295608 AAGTAAGCAAAGGCAGAGTAAGG - Intergenic
1144436260 17:15245413-15245435 AGGACAGCCCAGGCAGGGCTGGG + Intronic
1144718211 17:17449136-17449158 AACTAAGGACTGGCAGAGCTGGG + Intergenic
1144744474 17:17604492-17604514 CAGTGAGCCCAGGCAGGGCTTGG - Intergenic
1146297292 17:31659823-31659845 AAGTCGGGTCAGGAAGAGCTTGG + Intergenic
1147113633 17:38282312-38282334 GAGAGAGCCCAGGCAGAGCTGGG + Intergenic
1148165986 17:45484407-45484429 AAGTCAGCAGAAGAAAAGCTTGG - Intronic
1148227018 17:45906179-45906201 AAGTCAGCACTGGCAGGGGCTGG - Intronic
1148415980 17:47506873-47506895 GAGAGAGCCCAGGCAGAGCTGGG - Intergenic
1148702581 17:49598490-49598512 CAGCCAGCACATGCAGAACTGGG + Intergenic
1148832135 17:50440553-50440575 TAGAGACCACAGGCAGAGCTGGG - Intronic
1149847654 17:60016893-60016915 AAGTGAGCACAAGAGGAGCTGGG - Intergenic
1150272103 17:63873287-63873309 AAGCCAGGGCAGGCAGAGCAGGG + Exonic
1150275651 17:63896183-63896205 AAGCCAGGGCAGGCAGAGCAGGG + Exonic
1150277783 17:63910872-63910894 AAGCCAGGGCAGGCAGAGCAGGG + Exonic
1150397209 17:64831132-64831154 AAGTCAGCAGAAGAAAAGCTTGG - Intergenic
1150815911 17:68391763-68391785 GAGTCAGCACTCGCAGAGCACGG - Intronic
1155722568 18:29035575-29035597 ATACCAGCACAGGTAGAGCTGGG + Intergenic
1156479960 18:37430140-37430162 AAGTCAGCTCAGGCTGAGGTGGG - Intronic
1157086600 18:44586672-44586694 CAGGCAGCACATGCAGAGCTTGG - Intergenic
1159619666 18:70622727-70622749 CAGTCAGCACAGGAAGACCAGGG - Intergenic
1160374041 18:78397463-78397485 AGGACAGCACAGGCTGAGATGGG + Intergenic
1160876372 19:1298259-1298281 AGGGCAGCACAGGGTGAGCTCGG - Intronic
1161819418 19:6520391-6520413 TAGCCAGCAGAGGCAGAGCTGGG + Intergenic
1161842876 19:6693436-6693458 AAGGCCGCAAAGGCAGAGCTGGG + Exonic
1161968250 19:7561026-7561048 AAGTCAGTGAAGCCAGAGCTTGG - Exonic
1162148934 19:8631370-8631392 GGGTCAGCCCAGGCAGGGCTGGG + Intergenic
1162425423 19:10592507-10592529 CAGTCAGAAGAAGCAGAGCTGGG + Intergenic
1162776827 19:12984888-12984910 CAGTCAGTACAGGAAGAGCAGGG - Intergenic
1162776965 19:12985758-12985780 CAGGCTGCACAGGGAGAGCTGGG + Intergenic
1166033799 19:40152781-40152803 AAGACAGCACAGGCTGAGAGTGG + Intergenic
927377633 2:22436689-22436711 AAGTGAGAACATGCAGTGCTTGG + Intergenic
927834632 2:26383929-26383951 AAGTCAGCACAGGTCCAGTTTGG - Intronic
928092205 2:28381835-28381857 AGGGCACCAGAGGCAGAGCTGGG - Intergenic
928966966 2:36986285-36986307 AAGTCAGAAAAGGCAGTGTTTGG - Intronic
929998301 2:46843452-46843474 ATGTCATCAGAGGCAGAGGTTGG + Intronic
930243995 2:48964723-48964745 AAGTGAGCCCAAGGAGAGCTAGG - Intronic
931140406 2:59451941-59451963 AAGCCAGCACAGGTACAGCTTGG + Intergenic
931200208 2:60090347-60090369 GAGTCATCACAGGCAGAGGCAGG + Intergenic
931890288 2:66663693-66663715 ATGTCAAGACAGACAGAGCTGGG + Intergenic
932126760 2:69151782-69151804 GAGTCAGCCCAGGCAGAGACTGG + Intronic
932525930 2:72468059-72468081 ATGGCAGAACAGGCAGAGCATGG - Intronic
933487515 2:82941683-82941705 AAGTCAGCAAATGGAAAGCTAGG + Intergenic
933788064 2:85859631-85859653 CAGTTAGCAAAGGCACAGCTTGG - Intronic
935059002 2:99592215-99592237 AAGCAAGGACAGGGAGAGCTGGG - Intronic
935844547 2:107150974-107150996 AGGTCAGCACAGGTAGACTTGGG + Intergenic
936007957 2:108906885-108906907 AACTCGGGGCAGGCAGAGCTTGG + Intronic
936568470 2:113597428-113597450 AAGGCTGCTCAGGCAGGGCTGGG - Intergenic
938185129 2:129224853-129224875 TAGTAAGTAGAGGCAGAGCTGGG - Intergenic
940066530 2:149636121-149636143 GAGTCAGAACATGCAGTGCTTGG + Intergenic
942288627 2:174447703-174447725 AAGTAAGCACATGCAGTACTTGG - Intronic
942288919 2:174450230-174450252 AAGTGAGCACATGCAGCACTTGG - Intronic
942817636 2:180070976-180070998 GAGTCAGCACAAGGAGTGCTGGG - Intergenic
943655519 2:190504124-190504146 AAGTTCTCACTGGCAGAGCTGGG - Intronic
944329352 2:198446962-198446984 AAATAAACACAGGCAGAGTTGGG - Intronic
944989642 2:205220949-205220971 CACTCAGCCCAGGCAGGGCTTGG + Intronic
945867874 2:215196588-215196610 AAGTGAGAACATGCAGTGCTTGG - Intergenic
948735747 2:240003845-240003867 AGGACAGAAGAGGCAGAGCTGGG + Intronic
1169216477 20:3797199-3797221 AAGTCTGCAAGGGGAGAGCTGGG + Intronic
1169248547 20:4042950-4042972 ATGACAACAAAGGCAGAGCTTGG - Intergenic
1169577200 20:6977870-6977892 AAGTGAGCACATGCAAAGCGTGG + Intergenic
1170307613 20:14957463-14957485 AAGTGATGAGAGGCAGAGCTGGG + Intronic
1170454146 20:16516936-16516958 CAGTCAGCACAGGCAGTACAGGG + Intronic
1171148379 20:22805330-22805352 AAGGCAGCACAGAAAGGGCTGGG + Intergenic
1171294513 20:24005723-24005745 AAGAAAGCCCAGGCAGACCTTGG - Intergenic
1171297638 20:24032743-24032765 AAGTCAGGCCAGCCTGAGCTGGG - Intergenic
1171358991 20:24573388-24573410 AAAGCAGCACAGGCAAAGCTGGG - Intronic
1171364779 20:24616412-24616434 AAATCCCCAAAGGCAGAGCTGGG - Intronic
1171397091 20:24842403-24842425 AAGTCAGGAGGGACAGAGCTGGG + Intergenic
1172472247 20:35208196-35208218 AAGTCAGCACAGGATGTCCTTGG - Intergenic
1173062078 20:39672182-39672204 GCGTCACCACAGGCAGAGTTTGG - Intergenic
1173165063 20:40682407-40682429 AAGCCAGGACAGGAAGAGCTTGG + Intergenic
1174656435 20:52176031-52176053 CAATCAGCAAAGGCAGAGCTGGG - Intronic
1178043776 21:28671260-28671282 AAGTGAGAACAGGCAGTGGTGGG + Intergenic
1179798022 21:43796991-43797013 AGGACAGCACAGGCAGAGAAAGG - Intronic
1180181817 21:46121510-46121532 AAGTCAGCACAGGCAGGGACTGG - Intronic
1180221000 21:46357862-46357884 AAAACAGCACAGGAAGAGCCTGG - Intronic
1181180771 22:21066708-21066730 ATGTCAGCACAGGCCGGGCGCGG - Intergenic
1181333354 22:22111580-22111602 GAGTCAGAACAGGCCGAGGTGGG - Intergenic
1184352225 22:43951959-43951981 ATGACAGCAGAGGCAGTGCTGGG - Intronic
949433927 3:4007756-4007778 CAAGCAGAACAGGCAGAGCTGGG + Intronic
949625175 3:5857592-5857614 AAGTGAGAACATGCAGAGTTTGG + Intergenic
949869530 3:8576284-8576306 AATACAGCACAGGCAACGCTTGG - Intergenic
950093155 3:10311773-10311795 AAGCCAGACCAGGCAGGGCTTGG - Intronic
950375446 3:12568174-12568196 AAGGTAGCCCAGGCTGAGCTAGG + Intronic
950439551 3:13001282-13001304 AAGCCAGCACAGGCAGTGTGGGG - Intronic
950970588 3:17183151-17183173 GCGCCAGCACAGGCAGAGCTAGG - Intronic
951025278 3:17822010-17822032 AAGTGAGAACAGGCAGTGTTTGG - Intronic
953393651 3:42549263-42549285 AAGTGAGGACAGGCAGGGGTGGG - Intronic
955503375 3:59606929-59606951 AAGTCAGCAATGACAGATCTTGG + Intergenic
955818519 3:62873738-62873760 AAGGCAGCAGTGGCAGGGCTTGG + Intronic
957071215 3:75569355-75569377 AAGTGAGAACACGCAGAGTTTGG - Intergenic
957597970 3:82291986-82292008 AAGTCAGCACTGGCTGAGATAGG - Intergenic
957843532 3:85700877-85700899 AAGTGGGTACAGGCAGAGGTTGG - Intronic
958782723 3:98562340-98562362 AACTGAGCACAGGCTGACCTGGG - Intronic
959775609 3:110158635-110158657 AAGTGAGCACAAGCACATCTGGG + Intergenic
960856502 3:122107601-122107623 AGGTCAGCACAGGCAGTGATGGG - Intronic
961463374 3:127067167-127067189 CAGTGAGCACAGGTAAAGCTAGG - Intergenic
962259503 3:133894194-133894216 TGGTCTGCAGAGGCAGAGCTGGG + Intronic
963393088 3:144694496-144694518 ATGGCAGCACATGCAGTGCTGGG - Intergenic
963686401 3:148440155-148440177 AAGACAGCACAGGTATAGCAAGG - Intergenic
964655729 3:159064188-159064210 ATGTCAGCATGGGCAGAGGTAGG - Intronic
965609577 3:170530450-170530472 AAGTCACCAGAGCCAGAGCTTGG + Intronic
965785695 3:172332258-172332280 AACTCAGTACTGGCTGAGCTTGG - Intronic
966329819 3:178798632-178798654 AAGTGAGAACATGCAGTGCTTGG - Intronic
966773915 3:183527670-183527692 AAGTAAGCACAAGCCCAGCTAGG + Intronic
968975270 4:3818990-3819012 AACACACCACAGGCAGGGCTTGG + Intergenic
969058670 4:4417961-4417983 GAGTCAGCACAGGGAGGGGTGGG - Exonic
969453273 4:7286920-7286942 AAGTCAGCAGAGGCAGAGAGAGG + Intronic
970407374 4:15777005-15777027 AAGTGAGAACATGCAGTGCTTGG - Intergenic
971103536 4:23496740-23496762 GAGTCAGCAAAGGGAGAGCGGGG - Intergenic
971371587 4:26023735-26023757 GTGTCAGCACAGGCAGTGATTGG + Intergenic
971725266 4:30303805-30303827 AAGTAAGAACAGGCAGTGTTTGG - Intergenic
973884475 4:55306616-55306638 AAGAAAGCACAGGCGGAACTGGG + Intergenic
975494389 4:75021693-75021715 AAGTCAGAACATGCAGTGTTTGG + Intronic
977634599 4:99282578-99282600 AACACAGCACAGGTAGAGCCTGG + Exonic
977637289 4:99314053-99314075 AACACAGCACAGGTAGAGCCTGG + Exonic
979000405 4:115210269-115210291 AAGTGAGAACATGCAGTGCTTGG - Intergenic
981044603 4:140253316-140253338 AAGGCAGCGCAGGCGGAGCGCGG - Intergenic
982072862 4:151710680-151710702 AAGGCAGCAGAAGCTGAGCTAGG - Intronic
984270715 4:177545553-177545575 AAGTAAGAACAGGTAGAGATGGG + Intergenic
984647682 4:182237084-182237106 AAGTGAGAACAGGCAGTGTTTGG + Intronic
984926917 4:184815203-184815225 AAGTCTGAACAGGCAGAGACAGG + Intronic
985280567 4:188282634-188282656 AAGGCAGCGCAGGCCGATCTGGG - Intergenic
985686884 5:1286254-1286276 AGGCCAGCACAGGTAAAGCTGGG + Intronic
986529682 5:8723372-8723394 AAGTCATCCAAGGCAGAGCTGGG + Intergenic
987170657 5:15254016-15254038 CATTCAGAAGAGGCAGAGCTGGG - Intergenic
987260489 5:16197255-16197277 AACTGAGAACAGGCAGAGGTTGG - Intergenic
987410510 5:17610413-17610435 AGGTCTGCACAGCCAGTGCTGGG - Intergenic
988058482 5:26133635-26133657 AAGTGAGAACATGCAGAGTTTGG + Intergenic
988306329 5:29498892-29498914 ATGTGTGCACAGGCAGACCTTGG - Intergenic
990256317 5:53974235-53974257 AAGTGAGCACAGGCAGTGCCTGG + Intronic
990972436 5:61523343-61523365 ACCTCAGCAGAGGCAGAGCCTGG - Intronic
991170483 5:63619334-63619356 CATACAGCACATGCAGAGCTGGG + Intergenic
991400931 5:66250885-66250907 AAGTCAGCAGAGTCTGAGCTAGG - Intergenic
993917307 5:93758732-93758754 AATACAGCAAAGGCAGTGCTAGG + Intronic
995391329 5:111643033-111643055 AAGTAAGCACGGAAAGAGCTTGG - Intergenic
997904826 5:137806243-137806265 AAGACAGCAAAGGCGGAGGTGGG - Intergenic
998399067 5:141838556-141838578 TAGTTAGCGCAGGCAGAGCTGGG - Intergenic
998754855 5:145366056-145366078 AAGTCTGCACAGGCAGATTGAGG - Intergenic
999552194 5:152701555-152701577 CAATCTGCAGAGGCAGAGCTGGG - Intergenic
999807543 5:155097173-155097195 ACGTCAGCTTAGGCAGAGCAGGG - Intergenic
1000442813 5:161283367-161283389 CATACAGCACATGCAGAGCTTGG - Intergenic
1001339935 5:170833994-170834016 AAGACAGGAAAGGCAGTGCTAGG - Intergenic
1002294489 5:178222756-178222778 CAGTCAGGACAGGCTGAGGTTGG + Intronic
1002670934 5:180866552-180866574 AAGACAGAACAGGGACAGCTGGG + Intergenic
1002970791 6:2016892-2016914 CAGTCAGCAAAGGCAGTGCTGGG + Intronic
1003908733 6:10724787-10724809 AACTCAGCAAAGCCAGAGCTGGG - Intronic
1005682582 6:28221651-28221673 AAGTCAGTACTGACAGAGCATGG + Intergenic
1006424681 6:33956609-33956631 CAGGAAGCCCAGGCAGAGCTGGG - Intergenic
1006627258 6:35406216-35406238 AAGATAGCACAGGCTGGGCTGGG - Intronic
1008051143 6:46901584-46901606 AAGAAAGCACAGGCAGAGAGAGG + Intronic
1008191138 6:48459485-48459507 AAGTGAGAACAGGCAGTACTTGG + Intergenic
1008801510 6:55373982-55374004 AAGTGAGCACATGCAGTGTTCGG + Intronic
1012208560 6:96491746-96491768 AAGACAGAACTGGCAGACCTCGG + Intergenic
1012231285 6:96763175-96763197 AGGTCAGTACAGGTAGAGCTAGG - Intergenic
1015483448 6:133741635-133741657 TAGTCAGCATAGGAACAGCTTGG - Intergenic
1016183642 6:141176091-141176113 AAGGCAGCACAGGCCGGGCGCGG - Intergenic
1016405526 6:143725488-143725510 AAGACAGCACAGGCCGGGCGCGG - Intronic
1016515302 6:144886456-144886478 AACTCAGCACAGACAGAGACAGG + Intergenic
1016599494 6:145841977-145841999 AAATCAGCAGAAGCAGAGCCAGG + Intergenic
1016799383 6:148153366-148153388 CTGTGAGCACAGGCAGAGATGGG + Intergenic
1017271660 6:152514386-152514408 GAGTGAGAACATGCAGAGCTTGG - Intronic
1017813829 6:158002772-158002794 GAGGCAGAACAGGCAGGGCTGGG - Intronic
1018211212 6:161483934-161483956 AAGTGAGAACAGGCAGTGTTTGG - Intronic
1019152655 6:170019155-170019177 AAGCCAGCACAGGCAGGGGAGGG - Intergenic
1019329404 7:455250-455272 AGGTCAGGAGAGGCAGAGCTTGG - Intergenic
1019341563 7:511121-511143 CAGGCAGCAGAGGCTGAGCTGGG + Intronic
1019413852 7:918653-918675 ACGTCAGCACGGGCAGGGCGGGG - Intronic
1020215459 7:6186760-6186782 GACTCAGCACAGGCCGGGCTTGG - Intronic
1022495734 7:30851966-30851988 AAGACTGCAAAGGGAGAGCTTGG - Intronic
1022523176 7:31020756-31020778 AAGCCAGCATGGGCAGATCTTGG - Intergenic
1023112954 7:36832567-36832589 AAATCAGGAGAGGCTGAGCTAGG - Intergenic
1023971971 7:44998572-44998594 AAGTCAGCACATCCAGAGTTAGG + Intergenic
1024582407 7:50810540-50810562 AAGTCATCCCAGACATAGCTGGG + Intergenic
1026152145 7:67796855-67796877 AAGTCAATACAGGCAGTGATAGG + Intergenic
1026549062 7:71351574-71351596 AAGTGAAGACAGGCAGAGATTGG + Intronic
1027199321 7:76053135-76053157 AAGTCAGGACATGAAGAACTTGG - Intronic
1027430811 7:78110759-78110781 AGTTCAACACAGCCAGAGCTAGG + Intronic
1028300297 7:89191049-89191071 AATGCAACACAGGCAGAACTCGG - Intronic
1029387804 7:100255258-100255280 CAGTTAGCAAGGGCAGAGCTGGG + Intronic
1029459607 7:100687305-100687327 AATCCAGCGCAGCCAGAGCTGGG - Exonic
1032468097 7:132159387-132159409 CTGTCAGCAGAGGCAGGGCTGGG - Intronic
1032566610 7:132953545-132953567 CAGTCTGAATAGGCAGAGCTGGG - Intronic
1033239517 7:139665496-139665518 AGGTCAGCGCATGCATAGCTAGG - Intronic
1033427227 7:141255203-141255225 AAGGCATCAGAGGCAGAGCTGGG + Intronic
1034626196 7:152494672-152494694 CACTGAGCACAGCCAGAGCTGGG + Intergenic
1035570966 8:671894-671916 CAGTGAGCACAGACAGAGCCGGG - Intronic
1035618300 8:1018553-1018575 AGCCCAGCACAGGCAGAGCCAGG - Intergenic
1036006113 8:4665293-4665315 AAGTCAGCAAAGGGAGAGGAAGG - Intronic
1036511629 8:9405410-9405432 AAGTCAGCACAGTCAGTGTTAGG - Intergenic
1036633389 8:10531005-10531027 AATACAGCAAAGGCCGAGCTGGG - Intronic
1037128131 8:15374545-15374567 AAGAAAGCACAGGGAGAGGTGGG - Intergenic
1037660684 8:20924045-20924067 AAGTCAAGTCAGGCAGAGCCTGG + Intergenic
1037755677 8:21708692-21708714 GAGACAGCAGAGGCAGAGATAGG + Intronic
1038762984 8:30401916-30401938 AAGTCAGCCCAGGCAAAGCCTGG + Intronic
1038905314 8:31895629-31895651 ATGATAGCACAGGCAGAACTAGG - Intronic
1039596357 8:38793339-38793361 AAAACAGGACAGGCAGGGCTTGG - Intronic
1040560930 8:48523069-48523091 AAGTCTGCAGAGGCAGTGTTGGG + Intergenic
1040871653 8:52105873-52105895 AAGTCCCCACAGGCACAGCAAGG - Intergenic
1041254014 8:55963398-55963420 AAGGCAGCACAGGCAGTGGGTGG + Intronic
1042581407 8:70283034-70283056 AATTCAGTACAGACAGAGCTTGG + Intronic
1043352830 8:79381454-79381476 AAGTCTCCATAGGCAGAGCCAGG + Intergenic
1047218883 8:122902605-122902627 AGCTCAGAAGAGGCAGAGCTGGG - Intronic
1047753381 8:127899432-127899454 GAGTCAGCTCAGGCAGTTCTTGG + Intergenic
1048771468 8:137899901-137899923 AAGTCAACCCAGGCATAGATGGG + Intergenic
1049213638 8:141397981-141398003 CAGTCAGCGCAGGCGGAGCAGGG + Intronic
1049282621 8:141758120-141758142 CAGTGAGCACCGGCAGAGCTGGG + Intergenic
1049369432 8:142256755-142256777 AACTCGTCACTGGCAGAGCTGGG + Intronic
1049687906 8:143946330-143946352 AAGGTAGGGCAGGCAGAGCTGGG - Intronic
1049884059 9:16097-16119 AAGGCTGCTCAGGCAGGGCTGGG + Intergenic
1050403080 9:5277382-5277404 AAGTAAGAACATGCAGTGCTTGG - Intergenic
1051593661 9:18801614-18801636 AAGTGAGCACATGCAGTACTTGG + Intronic
1052829573 9:33203786-33203808 AAGTCAGCAGTGGCAGGGATAGG - Intergenic
1057455593 9:95207082-95207104 AAGTCAGCTCAGCCAGAAATTGG + Intronic
1057522984 9:95774925-95774947 AAGTGAACACAGGGAAAGCTGGG + Intergenic
1057916882 9:99063518-99063540 AAGTCAGCAAAGCAAGTGCTAGG + Intronic
1057948778 9:99353122-99353144 AAGGCAGCAGAGGCAGAGGCTGG + Intergenic
1058706605 9:107642627-107642649 TTGGCAGCAAAGGCAGAGCTAGG + Intergenic
1058778393 9:108308825-108308847 AAGTTCACACAGGCACAGCTGGG + Intergenic
1060750209 9:126163816-126163838 AGGTCACCAAAGGCAGAGCTGGG + Intergenic
1060823492 9:126674428-126674450 AAGTGTGAACAGGCAGAGATGGG + Intronic
1060904198 9:127290015-127290037 TAGTTAGTACAGGTAGAGCTGGG - Intronic
1061218698 9:129236622-129236644 CAGCCAGCAGTGGCAGAGCTGGG + Intergenic
1061372861 9:130207629-130207651 AAGTCAGTAGAAGCAGAGCCTGG + Intronic
1061902272 9:133679004-133679026 AAGTGACCTCAGGCAGAACTGGG - Intronic
1061958914 9:133978129-133978151 AGGCCAGGACAGGCAGGGCTGGG + Intronic
1185661874 X:1734912-1734934 CAGTCAGGAAAGACAGAGCTCGG - Intergenic
1186049358 X:5573935-5573957 AAGTCACCAGAGCTAGAGCTCGG - Intergenic
1186479283 X:9883767-9883789 AAGGAAGCAGAGTCAGAGCTGGG + Intronic
1186674330 X:11800001-11800023 AATTCAGCAGTGGCTGAGCTAGG - Intergenic
1187618283 X:21021825-21021847 AAGTGAGAACAGGCAGTGTTTGG - Intergenic
1189015566 X:37093155-37093177 AAGTCAGCCCAGGCAAAGCCTGG + Intergenic
1189272364 X:39760363-39760385 TAGACAGAAGAGGCAGAGCTGGG + Intergenic
1190057755 X:47191509-47191531 TCGTCAGCTCAGGAAGAGCTGGG - Intronic
1191888277 X:65912593-65912615 AAGTGAGAACATGCAGAGTTTGG + Intergenic
1193410682 X:81159141-81159163 AAGTGAGAACATGCAGTGCTTGG - Intronic
1194811409 X:98391407-98391429 AAGTCAGAACAGGCAGTATTTGG + Intergenic
1195048818 X:101078914-101078936 CAGTTAGCACAGGGAGAGCTGGG - Exonic
1195585911 X:106565415-106565437 AGGTGAATACAGGCAGAGCTGGG + Intergenic
1195809348 X:108812885-108812907 AAGTGAGAACATGCAGTGCTTGG + Intergenic
1196117297 X:112011530-112011552 AATTCAGCACAGCCAAAGCAAGG - Intronic
1196634280 X:117983098-117983120 AAGGCAGAAGAGACAGAGCTAGG + Intronic
1198549466 X:137729465-137729487 AAGTGAGAACATGCAGTGCTTGG + Intergenic
1200037655 X:153343861-153343883 ATGCCAGCCCAGGCACAGCTAGG - Intronic
1200282093 X:154785656-154785678 AAGTTTGCACAGGCAGAGGGAGG + Intronic
1200401751 X:156024062-156024084 AAGGCTGCTCAGGCAGGGCTGGG - Intergenic