ID: 902820729

View in Genome Browser
Species Human (GRCh38)
Location 1:18941738-18941760
Sequence CTGAGGTCTCACTATGAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 223
Summary {0: 1, 1: 1, 2: 3, 3: 14, 4: 204}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902820729_902820732 0 Left 902820729 1:18941738-18941760 CCTACCTCATAGTGAGACCTCAG 0: 1
1: 1
2: 3
3: 14
4: 204
Right 902820732 1:18941761-18941783 ACCAGCAATGTGACCCCCTGAGG 0: 1
1: 0
2: 1
3: 9
4: 119
902820729_902820741 28 Left 902820729 1:18941738-18941760 CCTACCTCATAGTGAGACCTCAG 0: 1
1: 1
2: 3
3: 14
4: 204
Right 902820741 1:18941789-18941811 TCCAAATCCACACAACGGGGAGG 0: 1
1: 0
2: 1
3: 9
4: 81
902820729_902820739 24 Left 902820729 1:18941738-18941760 CCTACCTCATAGTGAGACCTCAG 0: 1
1: 1
2: 3
3: 14
4: 204
Right 902820739 1:18941785-18941807 TGCTTCCAAATCCACACAACGGG 0: 1
1: 0
2: 3
3: 29
4: 156
902820729_902820738 23 Left 902820729 1:18941738-18941760 CCTACCTCATAGTGAGACCTCAG 0: 1
1: 1
2: 3
3: 14
4: 204
Right 902820738 1:18941784-18941806 CTGCTTCCAAATCCACACAACGG 0: 1
1: 0
2: 0
3: 40
4: 328
902820729_902820740 25 Left 902820729 1:18941738-18941760 CCTACCTCATAGTGAGACCTCAG 0: 1
1: 1
2: 3
3: 14
4: 204
Right 902820740 1:18941786-18941808 GCTTCCAAATCCACACAACGGGG 0: 1
1: 0
2: 0
3: 4
4: 86

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902820729 Original CRISPR CTGAGGTCTCACTATGAGGT AGG (reversed) Intronic
900867122 1:5276504-5276526 CTGAGATCTCCCTAAGAGGACGG + Intergenic
901465759 1:9419990-9420012 CTGAGGACTCAGCCTGAGGTAGG + Intergenic
901807209 1:11746057-11746079 CTGAGGCCTCACTGTGGGGCAGG - Intronic
902134693 1:14294844-14294866 CTGAGGGCTCTCTATGACCTAGG - Intergenic
902820729 1:18941738-18941760 CTGAGGTCTCACTATGAGGTAGG - Intronic
903221439 1:21871729-21871751 TTGAGCTCTCACTATGTGCTAGG - Intronic
903415004 1:23176608-23176630 CTGACATCTCACTATAAGGTCGG - Intronic
903685661 1:25130031-25130053 CTGAGTACTCACTATGTGCTAGG + Intergenic
903708917 1:25307257-25307279 CTGAGGTCTCACTGCGAGGTGGG + Intronic
903718202 1:25385161-25385183 CTGAGGTCTCACTGTGAGGTGGG - Intronic
904306496 1:29593413-29593435 TTGAGGGCTCACTATGTGGGGGG + Intergenic
904482803 1:30804821-30804843 CTGAGGGCTTACTATGTGCTGGG - Intergenic
905304353 1:37007204-37007226 TTTAGGTCTCCCAATGAGGTGGG + Intronic
905741202 1:40373435-40373457 CTGAGCTCTTACTATGCGCTAGG - Intronic
906345675 1:45012891-45012913 CTGAGGTCTGGCGATCAGGTGGG - Exonic
907222122 1:52914772-52914794 CTGAGATCTCTTTAAGAGGTTGG - Intronic
907537300 1:55175656-55175678 CTGAGCTCTTTCTATGAGCTAGG + Intronic
909488896 1:76204959-76204981 CTGAGGGCTCACTATGTGCATGG - Intronic
910677534 1:89829906-89829928 CTGAGATCTAACTAGGAGGAGGG - Intronic
913141295 1:115943769-115943791 TTGAGGACTTACTATGAGCTAGG + Intergenic
914212120 1:145589315-145589337 CTGAGGTCTGACTCTGAATTCGG + Intergenic
914250139 1:145915250-145915272 CTGAGCTCTTACTATATGGTAGG - Intronic
914364726 1:146968150-146968172 CTGAGGTCTGACTCTGAATTCGG - Intronic
914365489 1:146974441-146974463 CTGAGGTCTGACTCTGAATTCGG - Intronic
914486952 1:148118998-148119020 CTGAGGTCTGACTCTGAATTCGG + Intronic
915155883 1:153875800-153875822 CTGAGCTCTTACTATGTGCTAGG + Intronic
915568343 1:156729205-156729227 CTGTGGCCTCACGATGATGTAGG - Exonic
916242340 1:162652638-162652660 CTGAGTACCCACTATGTGGTAGG + Intronic
918430473 1:184454741-184454763 CTGAGGCCTCCCTAGAAGGTGGG + Intronic
924421056 1:243910513-243910535 CTGAGCACTCCCCATGAGGTGGG + Intergenic
1064962681 10:20983116-20983138 CTAAGGTCTCACCATGGGATAGG - Intronic
1067445118 10:46337080-46337102 CTGGGGCCGCACTGTGAGGTGGG + Intergenic
1067707972 10:48625170-48625192 CTATGACCTCACTATGAGGTAGG - Intronic
1068419616 10:56773265-56773287 ATGAGGTTCCTCTATGAGGTAGG + Intergenic
1070536044 10:77377916-77377938 CTGAGGTCTCACTATGAGCCAGG - Intronic
1070954883 10:80457160-80457182 TTGAAGTCTCAATATGAGCTGGG + Intronic
1072487221 10:95867104-95867126 ATCAGGGCTTACTATGAGGTAGG + Exonic
1074260646 10:111850012-111850034 CTGAGCACTCACTATGTGCTGGG - Intergenic
1075547952 10:123369679-123369701 TTGAGTGCTCACTATGAGCTTGG + Intergenic
1075990414 10:126833615-126833637 CTGAGCACTCACTATGTGCTAGG + Intergenic
1076374568 10:129974560-129974582 CTGAAGTCCCACAATGGGGTTGG - Intergenic
1077126438 11:940725-940747 CTGAGCTCTCACTTTGTGCTTGG + Intronic
1077161994 11:1118005-1118027 ATGAGGTCAGACCATGAGGTGGG + Intergenic
1079207598 11:18430340-18430362 ATGGGGTCTCACTCTGAGATGGG + Intronic
1079282628 11:19101274-19101296 CTGAGGTCTCACTAGAAGCCAGG - Intergenic
1079497222 11:21059308-21059330 CTGAGTACTGACTATGAGTTAGG - Intronic
1081487963 11:43546702-43546724 CTGAGGTCTCACCAGGAGAGAGG - Intergenic
1083021832 11:59515585-59515607 CTGAGGTCTCACACTGGGGAAGG + Exonic
1083023742 11:59532457-59532479 CTGAGGTCTCACACTGAGGAAGG + Intergenic
1086423498 11:86661068-86661090 CTGAGGTTACACTATCAGGAAGG + Intronic
1086559373 11:88149390-88149412 TTGAGGTCTTACTATGAGCCAGG - Intronic
1087711237 11:101555065-101555087 CTGAGCCCTCACTCTGTGGTAGG + Intronic
1089129327 11:116199644-116199666 CTGAGGTCTCACTTTTAGAATGG - Intergenic
1090253845 11:125269271-125269293 CTGCGGTCTCACTTTGGGGCTGG - Intronic
1091682538 12:2537374-2537396 CTGAGGTAACCCTATGAGGGAGG - Intronic
1092343197 12:7693748-7693770 ATGAGGTCTCACCATGAGGCTGG - Intronic
1094708957 12:32941936-32941958 CTGAGTTCTTACTATGGGTTAGG + Intergenic
1096574339 12:52543362-52543384 CTGGGGTCCCACCATGGGGTGGG - Intergenic
1098849391 12:75577353-75577375 CTGAGGTCTTACTATGTAGCAGG + Intergenic
1098899138 12:76094737-76094759 CTGTGGTGTCACTATGTGTTAGG - Intergenic
1101440892 12:104703650-104703672 CTGAGCTTTCACTCTGAGCTGGG - Intronic
1102803655 12:115760210-115760232 CTGTGATCACACAATGAGGTAGG + Intergenic
1103235492 12:119369047-119369069 CTGAGACCTCACTGTGTGGTTGG - Intronic
1106637120 13:31541053-31541075 CTGAGGTCTTGCTATGAGTAGGG + Intergenic
1106966333 13:35074389-35074411 CTTAGGTCACACAATGAGGAAGG - Intronic
1111086039 13:83375686-83375708 CTGAGTTCTCACTCATAGGTGGG - Intergenic
1112756105 13:102635359-102635381 CTGTGTTCTCATTATGTGGTGGG - Intronic
1112859605 13:103814254-103814276 CTGAGGGCTCAGTGTCAGGTGGG + Intergenic
1113558545 13:111258063-111258085 CTGAGGTCTCACTAGGTTGCAGG - Intronic
1120387709 14:83866703-83866725 ATAAGGTCTCATTCTGAGGTGGG + Intergenic
1120672924 14:87385505-87385527 CTGAGGTCTAAATATGCGATGGG + Intergenic
1120685588 14:87532786-87532808 CTGAGCTCTCTGTAGGAGGTGGG - Intergenic
1125529976 15:40406689-40406711 CTGAGGTTTCACTTGGAGGCTGG + Intronic
1125584597 15:40811122-40811144 CTGAGTACTCACTATGAGTCAGG - Intronic
1125768814 15:42151945-42151967 CTGAGTGCTCACTCTGAGGCAGG - Intronic
1128353800 15:66910157-66910179 CTGAGGTCACACAGTGAGTTAGG - Intergenic
1129382604 15:75177659-75177681 CTGAGGTCACCCTAGGAAGTTGG - Intergenic
1130754174 15:86745217-86745239 CTGAGGTCTTAGTATGTGATGGG + Intronic
1133522964 16:6576674-6576696 CTGAGGTCAAACTATGTGGAAGG + Intronic
1133542241 16:6767369-6767391 CTGTGGTCTTTCTAGGAGGTTGG - Intronic
1133572909 16:7059289-7059311 GTGAGGTCTCACCAAGGGGTGGG - Intronic
1134108465 16:11499971-11499993 TTGAGGTGTCTCTATGAAGTAGG - Intronic
1134812060 16:17176184-17176206 CTGAGCTCTCACTATGTGCCAGG + Intronic
1135132505 16:19864499-19864521 CTGAGGTCTCACTCAGTGGAAGG + Intronic
1136026735 16:27473570-27473592 CTGAGGTCACACTGTCAGGCAGG + Intronic
1137024259 16:35457135-35457157 CTGGGGTCTCACTTTGAGGGAGG + Intergenic
1138148280 16:54631645-54631667 CCGAGGTCCCATCATGAGGTGGG + Intergenic
1138495495 16:57406551-57406573 CTGAGCTCTCACTATAGGCTGGG - Intronic
1138555731 16:57770308-57770330 CTGAGTCCCCACTGTGAGGTGGG + Intronic
1139223336 16:65207975-65207997 CTAAGGTCCTACTATGGGGTAGG + Intergenic
1139251437 16:65500245-65500267 CTGAGGGCCAACTATGAGGCAGG + Intergenic
1142965814 17:3580352-3580374 CTGAGGTCCCACTATGTGCCAGG + Intronic
1146791303 17:35752291-35752313 TTGAGGATTTACTATGAGGTGGG + Intronic
1150682026 17:67292097-67292119 CTGAATTCTCACTTTGCGGTTGG + Intergenic
1151351583 17:73535062-73535084 CTGGGATGTCACTATGAGATGGG - Intronic
1151844682 17:76644176-76644198 ATGAGGGCTCACTCTGAGCTGGG + Intergenic
1153110680 18:1582736-1582758 CTGAGGTCCTCCTATGAGGGAGG + Intergenic
1158401975 18:57129191-57129213 CTGAGGGCTCGCTATGGAGTTGG + Intergenic
1159769030 18:72526999-72527021 CAGAGGTCTCACTATCAAGGAGG - Intergenic
1159881275 18:73860744-73860766 CTGTGGTCTCACTGTGGGGATGG - Intergenic
1161614370 19:5261716-5261738 CTGAGGTCCCATCATGAGGCAGG + Intronic
1161650965 19:5484630-5484652 CTGAGGTCAGAATATGAGGGCGG - Intergenic
1164627237 19:29737703-29737725 CTGAGGTCTCCCCATGCTGTCGG - Intergenic
1165342625 19:35223744-35223766 CTGAGGTCACACAGTGAGCTTGG - Intergenic
925350874 2:3200068-3200090 CTGGGGCCTCACTAAGAGCTGGG + Intronic
925554118 2:5110546-5110568 CTGAGTTCTTACTTGGAGGTTGG - Intergenic
926914855 2:17881207-17881229 CTGAGGTCTCACTAGGAGGAAGG + Intronic
928598964 2:32885122-32885144 CTGAGGGCTTACTATGGGCTTGG - Intergenic
929297110 2:40260842-40260864 CTTAGGTCGGACTATGAGGAAGG - Intronic
933804362 2:85987486-85987508 CTCAGGGCTCACTGTGGGGTGGG - Intergenic
937764043 2:125639207-125639229 CTGAGCACTTACTATGTGGTAGG + Intergenic
937876078 2:126826489-126826511 CTGGGGGCTCACCATGATGTTGG + Intergenic
940320856 2:152374863-152374885 CCTAGGTCTCACTTTCAGGTGGG + Intronic
941268824 2:163399523-163399545 CTGAGGACTTACTATGAGGCAGG + Intergenic
944307000 2:198189869-198189891 CTGAGGACTTACTATGTGTTGGG - Intronic
1173465539 20:43278330-43278352 CTGAGGTCTAATCCTGAGGTGGG - Intergenic
1173837109 20:46133083-46133105 CTGAGTGCTCACTATGTGCTAGG + Intergenic
1173868057 20:46325339-46325361 CTGAGGGCATACTATGAGGCAGG - Intergenic
1177134454 21:17294158-17294180 CTGTGGTCTGAGTATGTGGTTGG - Intergenic
1177360223 21:20058856-20058878 CTGAGGTCTCACTCTTTGGCTGG - Intergenic
1180198057 21:46209079-46209101 CTGAGGTCAAACTATGGGCTCGG + Intronic
1181542447 22:23580528-23580550 CTGAGGTCACACAGGGAGGTGGG + Intergenic
1182481811 22:30614179-30614201 CTGAGGTCTCACTGTGTGTCAGG - Intronic
1183392236 22:37552257-37552279 CTTTGTTCTCACTGTGAGGTGGG - Intergenic
1183668707 22:39259589-39259611 CTGATGTCTCTCTTTGAGGCTGG - Intergenic
1183693211 22:39403121-39403143 CTGAGCACTCACTATGTGCTAGG + Intronic
1183924599 22:41197132-41197154 CTGAGGGCTCTCTCTGAGCTGGG + Intergenic
949240140 3:1861462-1861484 CAGAGGTTTCAGTATGTGGTTGG + Intergenic
950288642 3:11765320-11765342 CTGAGCTCTTACTATGAGGCAGG + Intergenic
952232737 3:31448354-31448376 GTGAGGTCTTACCATGTGGTGGG - Intergenic
953252336 3:41257440-41257462 ATGAGGTCTCACTATGTTGCTGG - Intronic
953262651 3:41354691-41354713 ATGAGGTCCCACTCTGAGATGGG + Intronic
954067872 3:48121318-48121340 TTGAGTTCTCACAATGAGGTTGG + Intergenic
954320599 3:49829854-49829876 CTGATGCCTCACTAGGAGGCAGG + Intronic
954943253 3:54394031-54394053 CAGAGTTACCACTATGAGGTAGG + Intronic
955628469 3:60946481-60946503 CTGGGGTATGACTATGAGGTAGG + Intronic
956660380 3:71591525-71591547 ATGAGGTCTCACTATGTTGCTGG - Intergenic
958834176 3:99124537-99124559 CTGAGGTCTCACAAAGAGGAAGG + Intergenic
960147417 3:114218131-114218153 CTGAGTGCTCACTATGAGCCAGG - Intergenic
960686600 3:120300477-120300499 CTTAGGTCTGAGTCTGAGGTGGG - Intergenic
961241360 3:125414748-125414770 CTGATGCCTCACTGTGAGCTTGG - Intergenic
962748708 3:138417161-138417183 GTGAGGGCTCACTATGTGCTGGG + Intergenic
964035654 3:152193497-152193519 CTGAGCTCTCACTATCTGTTTGG - Intergenic
964770695 3:160221783-160221805 ATGAGGTCCCACTTTGAGCTTGG - Intergenic
966931449 3:184678279-184678301 CACAGGTCTGCCTATGAGGTGGG + Intronic
967868274 3:194208068-194208090 CTGAGCTCCCACTATGGGCTGGG + Intergenic
968278400 3:197457912-197457934 CTGAGGTCGAACCCTGAGGTCGG + Intergenic
969927210 4:10595868-10595890 CTGAGTGCTCACTATGTGCTAGG - Intronic
972137243 4:35907676-35907698 CTGAGGTCTCACAATCATGGTGG - Intergenic
975345926 4:73292828-73292850 CTGAGATCAAACTGTGAGGTGGG - Intergenic
976182768 4:82414755-82414777 CTGAGGTGGCAATATGAGTTAGG - Intergenic
976241136 4:82957885-82957907 CTGAGTGCTTACTATGTGGTAGG - Intronic
978374638 4:108061999-108062021 CTTAGGTCTCAGTAGGAGGAAGG + Intronic
985167090 4:187108026-187108048 CTTAGCTCTTACTATGAGTTAGG + Intergenic
989241868 5:39211268-39211290 TTTAGGTCTCTCTTTGAGGTTGG - Intronic
989339519 5:40357677-40357699 CTGAGTTCTGACTAGGAGGTGGG + Intergenic
993550035 5:89261983-89262005 CTGAGCACTCACTATGTGCTAGG - Intergenic
995266695 5:110170529-110170551 CTGAGGTCTCATCAGAAGGTTGG + Intergenic
997057802 5:130465731-130465753 CTCAGGGCTCACTATAAAGTAGG + Intergenic
997697458 5:135872922-135872944 CTGAGCTCTTACTAGGAGCTGGG - Intronic
997884742 5:137620110-137620132 CTCTGGTCTCACTATGAAGTGGG - Exonic
998660830 5:144235616-144235638 CTGAGGGCTTACTATGAGCCAGG - Intronic
1000045710 5:157520302-157520324 CTGGAGTCTCACGATGAGCTTGG - Intronic
1000375451 5:160576771-160576793 CTGGGGTCTAAGTATGAAGTAGG + Intronic
1004710616 6:18166655-18166677 ATGGGGTCTTACTATGAGATAGG - Intronic
1005546989 6:26882190-26882212 ATGCAGTCTCACTATGAGGCTGG - Intergenic
1005670971 6:28105647-28105669 CTGAGGTCTTACTAAGTGCTAGG + Intergenic
1006053279 6:31360255-31360277 ATGAGGTCTCACTATCAGGCTGG + Intergenic
1007479412 6:42140368-42140390 CTGAGGTCTCCCCTTGAGGGAGG + Intronic
1008406198 6:51121352-51121374 CTGAGAGCTAATTATGAGGTTGG - Intergenic
1011050483 6:83142780-83142802 ATGAGGTCTCACTTTGCTGTTGG + Intronic
1013128593 6:107209611-107209633 ATGAGGTTTCACTATGTTGTTGG + Intronic
1015166826 6:130207991-130208013 CTGAGCTCTCACGCTGAGGGTGG + Intronic
1015553783 6:134440011-134440033 CTGTGTTCTCATTTTGAGGTTGG + Intergenic
1017827460 6:158092572-158092594 ATGAGGTCTCACTATGTTGCTGG - Intronic
1018052384 6:160022602-160022624 CTGAGCTCCCACTATGTTGTAGG + Intronic
1022244620 7:28546670-28546692 TTGAGCTCTCAAGATGAGGTGGG - Intronic
1022410059 7:30132654-30132676 CTGAGTTCTTACTATGTGCTAGG + Intergenic
1023586416 7:41735375-41735397 CGGAAGTTTCACCATGAGGTTGG + Intergenic
1025802650 7:64801510-64801532 CTGTGGTCTGAGTATGTGGTTGG + Intronic
1029974671 7:104821803-104821825 GTGAGGTTTCACTTGGAGGTGGG - Intronic
1030414848 7:109230218-109230240 CTGAGATCTCACCAGGAAGTTGG + Intergenic
1032540261 7:132697237-132697259 CTGAGGTCTGGCTATGGGGCGGG + Intronic
1032616281 7:133474934-133474956 CTGAGGGCTTACTATGATGCAGG - Intronic
1034070222 7:148177244-148177266 TTGAGGTCATACTAGGAGGTTGG + Intronic
1034279282 7:149840966-149840988 CTGAGGTTTCACTTAGTGGTTGG - Intronic
1034295185 7:149966164-149966186 CTGAAGTCTGACTCTCAGGTTGG + Intergenic
1034810876 7:154130783-154130805 CTGAAGTCTGACTCTCAGGTTGG - Intronic
1035127338 7:156618049-156618071 CGGAGGTCTCACTATGCTGCTGG - Intergenic
1035616164 8:1003287-1003309 CTATGGCCTCACTATCAGGTGGG + Intergenic
1036037396 8:5034062-5034084 CTGAGGTCATAGTATGAGCTAGG + Intergenic
1036073485 8:5468507-5468529 CTTAGGTCTTACTATGAACTAGG - Intergenic
1036601887 8:10268562-10268584 TTGAGGTCTTACTATGTGCTAGG - Intronic
1038177694 8:25195876-25195898 CTGAGGACTTACTATGAGCCAGG - Intronic
1039627472 8:39068767-39068789 CTGGGACCTCAGTATGAGGTAGG + Intronic
1041407511 8:57516328-57516350 CTTAGGGCTCACTTTGAGCTGGG + Intergenic
1043785379 8:84391765-84391787 CTGAAGTCTCAGAATGAGCTAGG - Intronic
1048142021 8:131804042-131804064 CTGAGGACTTACTATGAGCCTGG - Intergenic
1048562035 8:135549986-135550008 CTAAGGGCTTACTATGTGGTAGG + Intronic
1053648849 9:40142688-40142710 CTGAGGCCTCACCAGGAGCTAGG - Intergenic
1053756895 9:41321165-41321187 CTGAGGCCTCACCAGGAGCTAGG + Intergenic
1054329828 9:63740629-63740651 CTGAGGCCTCACCAGGAGCTAGG - Intergenic
1054535734 9:66233482-66233504 CTGAGGCCTCACCAGGAGCTAGG + Intergenic
1056808988 9:89749914-89749936 CTGAGGTCACACAGTGAGGATGG + Intergenic
1057316040 9:93969127-93969149 CAGAGGCCTCACCAAGAGGTGGG + Intergenic
1059290550 9:113220563-113220585 CTGAGCACTCACTATGTGCTAGG + Intronic
1059421121 9:114193094-114193116 CTGAGGTCCCACTGTGAGTCTGG + Intronic
1060285607 9:122248918-122248940 CTGAGTTCTCACTGTGTAGTAGG + Intronic
1061102383 9:128502181-128502203 GTGAGATCTCAGTTTGAGGTAGG - Intergenic
1062301192 9:135871375-135871397 ATGGGGTCTCACTATGTTGTCGG + Intronic
1185918793 X:4066052-4066074 CTGACCTCTAACTATTAGGTTGG + Intergenic
1186113713 X:6282936-6282958 CTGAGCTCTCACCTGGAGGTTGG + Intergenic
1187310321 X:18135421-18135443 CTGAGGAGTCACAATGAGGTTGG + Intergenic
1189328797 X:40130224-40130246 TTGTGGTCACACTATGAGGTGGG + Intronic
1189472723 X:41326815-41326837 CTGAGGTCTCCCTAGGAAGAGGG - Intergenic
1192710360 X:73576601-73576623 CTGAGAACTCCATATGAGGTGGG - Intronic
1193734557 X:85141505-85141527 CTGAAGTCTCACCATATGGTAGG + Intergenic
1195444034 X:104930447-104930469 CTGAGTGCTCACTATGTGATAGG + Intronic
1195589736 X:106611013-106611035 ATGAAGTCTCTATATGAGGTAGG - Intergenic
1196865157 X:120064778-120064800 CTGAGCTCTCATTATGTGCTAGG + Intergenic
1196877936 X:120171502-120171524 CTGAGCTCTCATTATGTGCTAGG - Intergenic
1198590408 X:138174325-138174347 CTGAGGACTCACTGTGCGTTAGG + Intergenic
1199613198 X:149634938-149634960 CTGAGATCTCCCTGGGAGGTGGG + Intergenic