ID: 902821780

View in Genome Browser
Species Human (GRCh38)
Location 1:18947843-18947865
Sequence CGCCATGGCAATATTGTGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 43}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902821774_902821780 -6 Left 902821774 1:18947826-18947848 CCTCCTATTCTGCCACCCGCCAT 0: 1
1: 0
2: 0
3: 11
4: 157
Right 902821780 1:18947843-18947865 CGCCATGGCAATATTGTGACAGG 0: 1
1: 0
2: 0
3: 2
4: 43
902821772_902821780 9 Left 902821772 1:18947811-18947833 CCAGCGCAGCAGCCGCCTCCTAT 0: 1
1: 0
2: 0
3: 8
4: 139
Right 902821780 1:18947843-18947865 CGCCATGGCAATATTGTGACAGG 0: 1
1: 0
2: 0
3: 2
4: 43
902821771_902821780 10 Left 902821771 1:18947810-18947832 CCCAGCGCAGCAGCCGCCTCCTA 0: 1
1: 0
2: 0
3: 11
4: 204
Right 902821780 1:18947843-18947865 CGCCATGGCAATATTGTGACAGG 0: 1
1: 0
2: 0
3: 2
4: 43
902821773_902821780 -3 Left 902821773 1:18947823-18947845 CCGCCTCCTATTCTGCCACCCGC 0: 1
1: 0
2: 0
3: 23
4: 326
Right 902821780 1:18947843-18947865 CGCCATGGCAATATTGTGACAGG 0: 1
1: 0
2: 0
3: 2
4: 43
902821776_902821780 -9 Left 902821776 1:18947829-18947851 CCTATTCTGCCACCCGCCATGGC 0: 1
1: 0
2: 0
3: 10
4: 131
Right 902821780 1:18947843-18947865 CGCCATGGCAATATTGTGACAGG 0: 1
1: 0
2: 0
3: 2
4: 43

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902821780 Original CRISPR CGCCATGGCAATATTGTGAC AGG Intronic
900220478 1:1506358-1506380 CGTCAAGGCAATATAGAGACTGG - Intergenic
902821780 1:18947843-18947865 CGCCATGGCAATATTGTGACAGG + Intronic
906107491 1:43303717-43303739 TGCAGTGGCAATATTGTGGCAGG - Intronic
914392579 1:147235824-147235846 CTACATGGAAATATTGTCACGGG + Intronic
916900003 1:169211592-169211614 TGCCCTGGTAATATTGTGATAGG + Intronic
923289482 1:232530442-232530464 CTCCATGGCTAAAATGTGACAGG - Intronic
924141573 1:241029197-241029219 CCCCATGGTAATTTTGTGTCAGG - Intronic
1078576723 11:12509124-12509146 CCCCATGGCAAAATTTTGATAGG - Intronic
1079120506 11:17680702-17680724 CACCATGGCAATCTTTAGACAGG + Intergenic
1080057283 11:27919270-27919292 CTCCATGGGAATGTTGTCACAGG + Intergenic
1113150395 13:107257151-107257173 CCCCATGCCATTCTTGTGACAGG - Intronic
1114228209 14:20757715-20757737 GGACAGGGCAATACTGTGACTGG + Intergenic
1117428531 14:55627028-55627050 AGCCATGGGTATATTCTGACAGG + Intronic
1131214056 15:90522246-90522268 TGCCATGTGGATATTGTGACAGG - Intergenic
1132275941 15:100564016-100564038 CGCCACTGCAAAATTGTAACTGG + Intronic
1142027330 16:87821564-87821586 CGCCTTTGCAAAATTATGACAGG - Intergenic
1143886093 17:10066089-10066111 CGCCATAGCAATCTGGTCACTGG - Intronic
1145722139 17:27083209-27083231 GGCCATGGCACCATGGTGACAGG - Intergenic
1146756323 17:35434689-35434711 AGCCAGGGCAATATGGTGAGAGG + Intergenic
1160224946 18:77005349-77005371 CGCCATGGCAACATGGTACCTGG - Intronic
1160757089 19:763523-763545 TGCCATGGCGTTCTTGTGACGGG - Exonic
1168678436 19:58295992-58296014 GACCATGGCAATACTGTGAGGGG + Exonic
930871488 2:56175557-56175579 GGCCATGATCATATTGTGACTGG - Intergenic
930934462 2:56930800-56930822 AGCCTTGGCAATATTGGGAATGG - Intergenic
946999566 2:225438417-225438439 TGCTATGGCATTATGGTGACAGG + Intronic
1170182800 20:13551910-13551932 GGCCATGGCAATTTTGTAAGGGG + Intronic
1177264769 21:18768084-18768106 CTCTGTGGCAATATTGTGATGGG + Intergenic
1181886275 22:26024673-26024695 CGCCATGGCAATGATGGGCCCGG - Intronic
952315137 3:32225904-32225926 CCCCATGGCTATATTCTCACTGG + Intergenic
960978584 3:123201159-123201181 CGCCAAGGAAATATTGTGTGAGG - Intronic
966022291 3:175229810-175229832 TTCCATGCCAACATTGTGACTGG - Intronic
968581832 4:1398879-1398901 TGCCATGGCAATGGTGTGCCTGG - Intergenic
982616908 4:157649968-157649990 CTCCATGTCAATATTTTGATAGG - Intergenic
984607100 4:181797818-181797840 CGCCTTGACAATAATGTGACAGG + Intergenic
989512244 5:42301616-42301638 GGCCAGAGCAATATTGTCACAGG - Intergenic
1008459194 6:51748323-51748345 CTCCATGGCAACGTTGTGGCAGG - Exonic
1008483807 6:52014004-52014026 AGCCATGGCAGTGTTGAGACTGG - Intronic
1013388619 6:109659528-109659550 AGCAAATGCAATATTGTGACTGG + Intronic
1013395869 6:109738975-109738997 CACCAAGGCAATCTGGTGACTGG - Intronic
1016810743 6:148259077-148259099 GGCCATGTCTATATTATGACTGG + Intergenic
1018211897 6:161490242-161490264 CGCCATGGCACTTTTGTGCTGGG - Intronic
1028353243 7:89876038-89876060 AACCATGGCAATGTTGTTACTGG - Intergenic
1056757515 9:89391207-89391229 TGCCATGGCAATAGTGTGCCTGG - Intronic
1057500189 9:95590676-95590698 AGCCATGGTAAAAATGTGACAGG - Intergenic
1195945546 X:110206823-110206845 AGCCATGGCCATATTATTACAGG - Intronic
1201394309 Y:13531923-13531945 GCCCATGCCAATATTGTGAATGG + Intergenic