ID: 902826662

View in Genome Browser
Species Human (GRCh38)
Location 1:18979243-18979265
Sequence CAGAGGGAACAGCAAGACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902826653_902826662 18 Left 902826653 1:18979202-18979224 CCTCACTGTTGGAGGGTCGGCTT No data
Right 902826662 1:18979243-18979265 CAGAGGGAACAGCAAGACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902826662 Original CRISPR CAGAGGGAACAGCAAGACCA TGG Intergenic
No off target data available for this crispr