ID: 902828299

View in Genome Browser
Species Human (GRCh38)
Location 1:18992700-18992722
Sequence GTGGAGAAACAGGTTGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902828299_902828303 3 Left 902828299 1:18992700-18992722 CCAGCCTCAACCTGTTTCTCCAC No data
Right 902828303 1:18992726-18992748 TCATCCTCCATCCCAGTCAATGG No data
902828299_902828308 28 Left 902828299 1:18992700-18992722 CCAGCCTCAACCTGTTTCTCCAC No data
Right 902828308 1:18992751-18992773 TCACATCCACCCAGTTGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902828299 Original CRISPR GTGGAGAAACAGGTTGAGGC TGG (reversed) Intergenic
No off target data available for this crispr