ID: 902830588

View in Genome Browser
Species Human (GRCh38)
Location 1:19009885-19009907
Sequence CTGAGAGAGCTTGTGGCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902830581_902830588 -6 Left 902830581 1:19009868-19009890 CCTGTCCTTTCTCTCCCCTGAGA No data
Right 902830588 1:19009885-19009907 CTGAGAGAGCTTGTGGCCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902830588 Original CRISPR CTGAGAGAGCTTGTGGCCTT GGG Intergenic
No off target data available for this crispr