ID: 902831290

View in Genome Browser
Species Human (GRCh38)
Location 1:19014591-19014613
Sequence CCCTCTGAGCAGGGACTCAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902831283_902831290 11 Left 902831283 1:19014557-19014579 CCTTCACTGAGCTGCAACTACTG No data
Right 902831290 1:19014591-19014613 CCCTCTGAGCAGGGACTCAAAGG No data
902831282_902831290 22 Left 902831282 1:19014546-19014568 CCAAACTCAGGCCTTCACTGAGC No data
Right 902831290 1:19014591-19014613 CCCTCTGAGCAGGGACTCAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902831290 Original CRISPR CCCTCTGAGCAGGGACTCAA AGG Intergenic
No off target data available for this crispr