ID: 902832911

View in Genome Browser
Species Human (GRCh38)
Location 1:19029283-19029305
Sequence AAACCCGGCACCCCGGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902832903_902832911 1 Left 902832903 1:19029259-19029281 CCTCCTCATCTGGTTCATTCCCC No data
Right 902832911 1:19029283-19029305 AAACCCGGCACCCCGGAGATGGG No data
902832901_902832911 14 Left 902832901 1:19029246-19029268 CCGCTGCGACTAGCCTCCTCATC No data
Right 902832911 1:19029283-19029305 AAACCCGGCACCCCGGAGATGGG No data
902832900_902832911 26 Left 902832900 1:19029234-19029256 CCAGTGAGGGCACCGCTGCGACT No data
Right 902832911 1:19029283-19029305 AAACCCGGCACCCCGGAGATGGG No data
902832904_902832911 -2 Left 902832904 1:19029262-19029284 CCTCATCTGGTTCATTCCCCAAA No data
Right 902832911 1:19029283-19029305 AAACCCGGCACCCCGGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902832911 Original CRISPR AAACCCGGCACCCCGGAGAT GGG Intergenic
No off target data available for this crispr