ID: 902834082

View in Genome Browser
Species Human (GRCh38)
Location 1:19035599-19035621
Sequence ACTGCAGGTGTCACACATCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902834082_902834086 -5 Left 902834082 1:19035599-19035621 CCTGGATGTGTGACACCTGCAGT No data
Right 902834086 1:19035617-19035639 GCAGTTACACAGGGCTCAGAAGG No data
902834082_902834087 7 Left 902834082 1:19035599-19035621 CCTGGATGTGTGACACCTGCAGT No data
Right 902834087 1:19035629-19035651 GGCTCAGAAGGACCCACCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902834082 Original CRISPR ACTGCAGGTGTCACACATCC AGG (reversed) Intergenic
No off target data available for this crispr