ID: 902835708

View in Genome Browser
Species Human (GRCh38)
Location 1:19045397-19045419
Sequence GTCAAAGGCAGCTCTGTTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902835708_902835716 16 Left 902835708 1:19045397-19045419 CCATGAACAGAGCTGCCTTTGAC No data
Right 902835716 1:19045436-19045458 CCCCCAGTGTCCCCTGAGGCTGG No data
902835708_902835712 12 Left 902835708 1:19045397-19045419 CCATGAACAGAGCTGCCTTTGAC No data
Right 902835712 1:19045432-19045454 TGCCCCCCCAGTGTCCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902835708 Original CRISPR GTCAAAGGCAGCTCTGTTCA TGG (reversed) Intergenic
No off target data available for this crispr