ID: 902835710

View in Genome Browser
Species Human (GRCh38)
Location 1:19045412-19045434
Sequence GCATTGTCCTCTGGAGTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902835710_902835712 -3 Left 902835710 1:19045412-19045434 CCTTTGACTCCAGAGGACAATGC No data
Right 902835712 1:19045432-19045454 TGCCCCCCCAGTGTCCCCTGAGG No data
902835710_902835716 1 Left 902835710 1:19045412-19045434 CCTTTGACTCCAGAGGACAATGC No data
Right 902835716 1:19045436-19045458 CCCCCAGTGTCCCCTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902835710 Original CRISPR GCATTGTCCTCTGGAGTCAA AGG (reversed) Intergenic
No off target data available for this crispr