ID: 902835711

View in Genome Browser
Species Human (GRCh38)
Location 1:19045421-19045443
Sequence ACTGGGGGGGCATTGTCCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902835711_902835716 -8 Left 902835711 1:19045421-19045443 CCAGAGGACAATGCCCCCCCAGT No data
Right 902835716 1:19045436-19045458 CCCCCAGTGTCCCCTGAGGCTGG No data
902835711_902835725 30 Left 902835711 1:19045421-19045443 CCAGAGGACAATGCCCCCCCAGT No data
Right 902835725 1:19045474-19045496 CACTGTCTGCTCCCTCAGAGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902835711 Original CRISPR ACTGGGGGGGCATTGTCCTC TGG (reversed) Intergenic
No off target data available for this crispr