ID: 902835712

View in Genome Browser
Species Human (GRCh38)
Location 1:19045432-19045454
Sequence TGCCCCCCCAGTGTCCCCTG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902835710_902835712 -3 Left 902835710 1:19045412-19045434 CCTTTGACTCCAGAGGACAATGC No data
Right 902835712 1:19045432-19045454 TGCCCCCCCAGTGTCCCCTGAGG No data
902835708_902835712 12 Left 902835708 1:19045397-19045419 CCATGAACAGAGCTGCCTTTGAC No data
Right 902835712 1:19045432-19045454 TGCCCCCCCAGTGTCCCCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902835712 Original CRISPR TGCCCCCCCAGTGTCCCCTG AGG Intergenic
No off target data available for this crispr