ID: 902835716

View in Genome Browser
Species Human (GRCh38)
Location 1:19045436-19045458
Sequence CCCCCAGTGTCCCCTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902835708_902835716 16 Left 902835708 1:19045397-19045419 CCATGAACAGAGCTGCCTTTGAC No data
Right 902835716 1:19045436-19045458 CCCCCAGTGTCCCCTGAGGCTGG No data
902835711_902835716 -8 Left 902835711 1:19045421-19045443 CCAGAGGACAATGCCCCCCCAGT No data
Right 902835716 1:19045436-19045458 CCCCCAGTGTCCCCTGAGGCTGG No data
902835710_902835716 1 Left 902835710 1:19045412-19045434 CCTTTGACTCCAGAGGACAATGC No data
Right 902835716 1:19045436-19045458 CCCCCAGTGTCCCCTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902835716 Original CRISPR CCCCCAGTGTCCCCTGAGGC TGG Intergenic
No off target data available for this crispr