ID: 902836809

View in Genome Browser
Species Human (GRCh38)
Location 1:19052825-19052847
Sequence ACGAATGGAAGGTGACCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902836809_902836815 3 Left 902836809 1:19052825-19052847 CCACCGGGTCACCTTCCATTCGT No data
Right 902836815 1:19052851-19052873 CAGAGCTCAGGCATCCTCTGTGG No data
902836809_902836818 24 Left 902836809 1:19052825-19052847 CCACCGGGTCACCTTCCATTCGT No data
Right 902836818 1:19052872-19052894 GGGCCACTCCCCCACCTATGTGG No data
902836809_902836816 4 Left 902836809 1:19052825-19052847 CCACCGGGTCACCTTCCATTCGT No data
Right 902836816 1:19052852-19052874 AGAGCTCAGGCATCCTCTGTGGG No data
902836809_902836812 -9 Left 902836809 1:19052825-19052847 CCACCGGGTCACCTTCCATTCGT No data
Right 902836812 1:19052839-19052861 TCCATTCGTTGCCAGAGCTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902836809 Original CRISPR ACGAATGGAAGGTGACCCGG TGG (reversed) Intergenic
No off target data available for this crispr