ID: 902837170

View in Genome Browser
Species Human (GRCh38)
Location 1:19054593-19054615
Sequence ACAAAGGCTGTTCCCACTGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902837170_902837174 0 Left 902837170 1:19054593-19054615 CCCACAGTGGGAACAGCCTTTGT No data
Right 902837174 1:19054616-19054638 GCCCCCCAGATTCCACAGAAGGG No data
902837170_902837183 24 Left 902837170 1:19054593-19054615 CCCACAGTGGGAACAGCCTTTGT No data
Right 902837183 1:19054640-19054662 AACTGAGTCTTGGCTCTGCCAGG No data
902837170_902837173 -1 Left 902837170 1:19054593-19054615 CCCACAGTGGGAACAGCCTTTGT No data
Right 902837173 1:19054615-19054637 TGCCCCCCAGATTCCACAGAAGG No data
902837170_902837182 14 Left 902837170 1:19054593-19054615 CCCACAGTGGGAACAGCCTTTGT No data
Right 902837182 1:19054630-19054652 ACAGAAGGGGAACTGAGTCTTGG No data
902837170_902837176 1 Left 902837170 1:19054593-19054615 CCCACAGTGGGAACAGCCTTTGT No data
Right 902837176 1:19054617-19054639 CCCCCCAGATTCCACAGAAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902837170 Original CRISPR ACAAAGGCTGTTCCCACTGT GGG (reversed) Intergenic
No off target data available for this crispr