ID: 902838960

View in Genome Browser
Species Human (GRCh38)
Location 1:19063412-19063434
Sequence GAGAGGCGTGTGGTAGCAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838960_902838963 -6 Left 902838960 1:19063412-19063434 CCACTTGCTACCACACGCCTCTC No data
Right 902838963 1:19063429-19063451 CCTCTCAGCGCCCCACCCTCCGG No data
902838960_902838971 24 Left 902838960 1:19063412-19063434 CCACTTGCTACCACACGCCTCTC No data
Right 902838971 1:19063459-19063481 ACCAATGTCCTCTTGTTCCCTGG No data
902838960_902838964 -3 Left 902838960 1:19063412-19063434 CCACTTGCTACCACACGCCTCTC No data
Right 902838964 1:19063432-19063454 CTCAGCGCCCCACCCTCCGGCGG No data
902838960_902838973 25 Left 902838960 1:19063412-19063434 CCACTTGCTACCACACGCCTCTC No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838960 Original CRISPR GAGAGGCGTGTGGTAGCAAG TGG (reversed) Intergenic