ID: 902838961

View in Genome Browser
Species Human (GRCh38)
Location 1:19063422-19063444
Sequence GTGGGGCGCTGAGAGGCGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838961_902838973 15 Left 902838961 1:19063422-19063444 CCACACGCCTCTCAGCGCCCCAC No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838961_902838971 14 Left 902838961 1:19063422-19063444 CCACACGCCTCTCAGCGCCCCAC No data
Right 902838971 1:19063459-19063481 ACCAATGTCCTCTTGTTCCCTGG No data
902838961_902838975 26 Left 902838961 1:19063422-19063444 CCACACGCCTCTCAGCGCCCCAC No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838961 Original CRISPR GTGGGGCGCTGAGAGGCGTG TGG (reversed) Intergenic