ID: 902838962

View in Genome Browser
Species Human (GRCh38)
Location 1:19063429-19063451
Sequence CCGGAGGGTGGGGCGCTGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838962_902838975 19 Left 902838962 1:19063429-19063451 CCTCTCAGCGCCCCACCCTCCGG No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838962_902838973 8 Left 902838962 1:19063429-19063451 CCTCTCAGCGCCCCACCCTCCGG No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838962_902838971 7 Left 902838962 1:19063429-19063451 CCTCTCAGCGCCCCACCCTCCGG No data
Right 902838971 1:19063459-19063481 ACCAATGTCCTCTTGTTCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838962 Original CRISPR CCGGAGGGTGGGGCGCTGAG AGG (reversed) Intergenic