ID: 902838965

View in Genome Browser
Species Human (GRCh38)
Location 1:19063439-19063461
Sequence GGTGTCACCGCCGGAGGGTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838965_902838973 -2 Left 902838965 1:19063439-19063461 CCCCACCCTCCGGCGGTGACACC No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data
902838965_902838971 -3 Left 902838965 1:19063439-19063461 CCCCACCCTCCGGCGGTGACACC No data
Right 902838971 1:19063459-19063481 ACCAATGTCCTCTTGTTCCCTGG No data
902838965_902838978 26 Left 902838965 1:19063439-19063461 CCCCACCCTCCGGCGGTGACACC No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838965_902838980 27 Left 902838965 1:19063439-19063461 CCCCACCCTCCGGCGGTGACACC No data
Right 902838980 1:19063489-19063511 CCTGGACGCTGTCTCAGTGAGGG No data
902838965_902838975 9 Left 902838965 1:19063439-19063461 CCCCACCCTCCGGCGGTGACACC No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838965 Original CRISPR GGTGTCACCGCCGGAGGGTG GGG (reversed) Intergenic