ID: 902838966

View in Genome Browser
Species Human (GRCh38)
Location 1:19063440-19063462
Sequence TGGTGTCACCGCCGGAGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
902838966_902838975 8 Left 902838966 1:19063440-19063462 CCCACCCTCCGGCGGTGACACCA No data
Right 902838975 1:19063471-19063493 TTGTTCCCTGGGACAGAGCCTGG No data
902838966_902838980 26 Left 902838966 1:19063440-19063462 CCCACCCTCCGGCGGTGACACCA No data
Right 902838980 1:19063489-19063511 CCTGGACGCTGTCTCAGTGAGGG No data
902838966_902838971 -4 Left 902838966 1:19063440-19063462 CCCACCCTCCGGCGGTGACACCA No data
Right 902838971 1:19063459-19063481 ACCAATGTCCTCTTGTTCCCTGG No data
902838966_902838978 25 Left 902838966 1:19063440-19063462 CCCACCCTCCGGCGGTGACACCA No data
Right 902838978 1:19063488-19063510 GCCTGGACGCTGTCTCAGTGAGG No data
902838966_902838973 -3 Left 902838966 1:19063440-19063462 CCCACCCTCCGGCGGTGACACCA No data
Right 902838973 1:19063460-19063482 CCAATGTCCTCTTGTTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
902838966 Original CRISPR TGGTGTCACCGCCGGAGGGT GGG (reversed) Intergenic